Previous Contig 012436:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMSF025M01Sequence611006321 (5)gb:AF150881_17726122e-57Lycopersicon esculentum x Lycopersicon peruvianum ferulate-5-hydroxylase (CYP84)135012436 (2)
JMSF033D09Sequence698006321 (5)gb:AY596978_16170296e-88Centaurium erythraea coniferylalcohol 5-hydroxylase mRNA, complete cds.295012436 (2)

Alignment

This contig is upended


. : . : . : . : . : . :
rJMSF033D09+ GNCGTTTTTGGNCTC
                      ____________________________________________________________
consensus GNCGTTTTTGGNCTC
 
. : . : . : . : . : . :
rJMSF033D09+ NNTGNGCCCCTNGCCGANTGNNTTGTTGCCGTCCCCCCTCCCCNCCTGNTTTGCCCNNTT
                      ____________________________________________________________
consensus NNTGNGCCCCTNGCCGANTGNNTTGTTGCCGTCCCCCCTCCCCNCCTGNTTTGCCCNNTT
 
. : . : . : . : . : . :
rJMSF033D09+ TANTGNTCCAANTCAAANNTNTTNGTCNAAGGGGAANTTAANTTCNNGCNNATATGGNTC
                      ____________________________________________________________
consensus TANTGNTCCAANTCAAANNTNTTNGTCNAAGGGGAANTTAANTTCNNGCNNATATGGNTC
 
. : . : . : . : . : . :
rJMSF033D09+ NCAAAAGNTGAACCNACCNGCNAANTAAAGGAAAANGNCGNTTNTTGNGNCGGNTTGGNT
                      ____________________________________________________________
consensus NCAAAAGNTGAACCNACCNGCNAANTAAAGGAAAANGNCGNTTNTTGNGNCGGNTTGGNT
 
. : . : . : . : . : . :
rJMSF033D09+ TGNTTGGANANTAAGTNNTTTTTTTTTTTTCTTGAACTTGTATCTGTATATGAGATCACT
rJMSF025M01+ TTTTTTTTTTTTCTTGAACTTGTATCTGTATATGAGATCACT
                      ____________________________________________________________
consensus TGNTTGGANANTAAGTNNTTTTTTTTTTTTCTTGAACTTGTATCTGTATATGAGATCACT
 
. : . : . : . : . : . :
rJMSF033D09+ CTTTCTCATATTTGGAATGTATACTTTTTTGTTTTTG
rJMSF025M01+ CTTTCTCATATTTGGAATGTATACTTTTTTGTTTTTGGACATTTCATCACACAAATCATA
                      ____________________________________________________________
consensus CTTTCTCATATTTGGAATGTATACTTTTTTGTTTTTGGACATTTCATCACACAAATCATA