Previous Contig 012432:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMSF025K21Sequence681006564 (6)gb:BT004019_16371332e-09Arabidopsis thaliana clone RAFL15-24-A22 (R20536) unknown protein (At5g04500) mR768012432 (3)gb:AC087851_17341915e-47Oryza sativa chromosome 3 BAC OSJNBb0072E24 genomic sequence, complete sequence.
JMSF029B18Sequence601006564 (6)683012432 (3)gb:AC087851_17341911e-68Oryza sativa chromosome 3 BAC OSJNBb0072E24 genomic sequence, complete sequence.
JMSF030G13Sequence689006564 (6)gb:BT004019_16371335e-26Arabidopsis thaliana clone RAFL15-24-A22 (R20536) unknown protein (At5g04500) mR724012432 (3)gb:AC087851_17341913e-81Oryza sativa chromosome 3 BAC OSJNBb0072E24 genomic sequence, complete sequence.

Alignment

This contig is upended


. : . : . : . : . : . :
rJMSF030G13+ ACTCTGCGGTGCCGGT
                      ____________________________________________________________
consensus ACTCTGCGGTGCCGGT
 
. : . : . : . : . : . :
rJMSF030G13+ GAGGATACGGGTGGAGGAAAAGAACTCGTTAAACAACTGATTCAAGGTGGATCCGTTGAT
                      ____________________________________________________________
consensus GAGGATACGGGTGGAGGAAAAGAACTCGTTAAACAACTGATTCAAGGTGGATCCGTTGAT
 
. : . : . : . : . : . :
rJMSF030G13+ AAAGACCCGAGCTGTCCTCGAGCTCGACGACGACATTATGATGACGTGCAACGACATTGA
rJMSF029B18+ CTCGACGACGACATTATGATGACGTGCAACGACATTGA
                      ____________________________________________________________
consensus AAAGACCCGAGCTGTCCTCGAGCTCGACGACGACATTATGATGACGTGCAACGACATTGA
 
. : . : . : . : . : . :
rJMSF030G13+ ACGAGGGTTTTTCATATGGCGTGAGCATCCGGATAGGATCGTCGGGTACTACCCCCGCCT
rJMSF029B18+ ACGAGGGTTTTTCATATGGCGTGAGCATCCGGATAGGATCGTCGGGTACTACCCCCGCCT
                      ____________________________________________________________
consensus ACGAGGGTTTTTCATATGGCGTGAGCATCCGGATAGGATCGTCGGGTACTACCCCCGCCT
 
. : . : . : . : . : . :
rJMSF030G13+ CGCTAACGGGAGCCCGTTGAAGTACCGGGCCGAGAGACACGCTCGCAAGCACAACGGATA
rJMSF029B18+ CGCTAACGGGAGCCCGTTGAAGTACCGGGCCGAGAGACACGCTCGCAAGCACAACGGATA
rJMSF025K21+ CCCGTTGAAGTACCGGGCCGAGAGACACGCTCGCAAGCACAACGGATA
                      ____________________________________________________________
consensus CGCTAACGGGAGCCCGTTGAAGTACCGGGCCGAGAGACACGCTCGCAAGCACAACGGATA
 
. : . : . : . : . : . :
rJMSF030G13+ CAACATGATACTGACGGGGGCGGCGTTCATGGACGCCCAAACGGCTTTCGAGAGGTACTG
rJMSF029B18+ CAACATGATACTGACGGGGGCGGCGTTCATGGACGCCCAAACGGCTTTCGAGAGGTACTG
rJMSF025K21+ CAACATGATACTGACGGGGGCGGCGTTCATGGACGCCCAAACGGCTTTCGAGAGGTACTG
                      ____________________________________________________________
consensus CAACATGATACTGACGGGGGCGGCGTTCATGGACGCCCAAACGGCTTTCGAGAGGTACTG
 
. : . : . : . : . : . :
rJMSF030G13+ GAGCAAGGAAGCTGCAGGCGGGAGGGAAGCCGTGGACAAGTTCTTTAACTGCGAGGACGT
rJMSF029B18+ GAGCAAGGAAGCTGCAGGCGGGAGGGAAGCCGTGGACAAGTTCTTTAACTGCGAGGACGT
rJMSF025K21+ GAGCAAGGAAGCTGCAGGCGGGAGGGAAGCCGTGGACAAGTTCTTTAACTGCGAGGACGT
                      ____________________________________________________________
consensus GAGCAAGGAAGCTGCAGGCGGGAGGGAAGCCGTGGACAAGTTCTTTAACTGCGAGGACGT
 
. : . : . : . : . : . :
rJMSF030G13+ GCTACTGAACTACCTATACGCAAACGCGAGCTCTTCTTCTTCTTCTTCCAACACGGTCGA
rJMSF029B18+ GCTACTGAACTACCTATACGCAAACGCGAGCTCTTCTTCTTCTTCTTCCAACACGGTCGA
rJMSF025K21+ GCTACTGAACTACCTATACGCAAACGCGAGCTCTTCTTCTTCTTCTTCCAACACGGTCGA
                      ____________________________________________________________
consensus GCTACTGAACTACCTATACGCAAACGCGAGCTCTTCTTCTTCTTCTTCCAACACGGTCGA
 
. : . : . : . : . : . :
rJMSF030G13+ ATACGTGAAACCTGCGTGGGCGATCGACATGTCGAAGTTCTCCGGTGTTGCAATCAGCGG
rJMSF029B18+ ATACGTGAAACCTGCGTGGGCGATCGACATGTCGAAGTTCTCCGGTGTTGCAATCAGCGG
rJMSF025K21+ ATACTTGAAACCTGCGTGGGCGATCGACATGTCGAAGTTCTCCGGTGTTGCAATCAGCGG
                      ____________________________________________________________
consensus ATACGTGAAACCTGCGTGGGCGATCGACATGTCGAAGTTCTCCGGTGTTGCAATCAGCGG
 
. : . : . : . : . : . :
rJMSF030G13+ CAACACGCAAGCACACTACAAAGTGAGGAGCAAATGCCTCCGGAAGTTCTCGGAGATGTA
rJMSF029B18+ CAACACGCAAGCACACTACAAAGTGAGGAGCAAATGCCTCCGGAAGTTCTCGGAGATGTA
rJMSF025K21+ CAACACGCAAGCACACTACAAAGTGAGGAGCAAATGCCTCCGGAAGTTCTCGGAGATGTA
                      ____________________________________________________________
consensus CAACACGCAAGCACACTACAAAGTGAGGAGCAAATGCCTCCGGAAGTTCTCGGAGATGTA
 
. : . : . : . : . : . :
rJMSF030G13+ CGGGAGCATAGCGGGCCGGAAATCGGAGTTTGGCAGCCGGATGGACGGCTGGGATGTATA
rJMSF029B18+ CGGGAGCATAGCGGGCCGGAAATCGGAGTTTGGCAGCCGGATGGACGGCTGGGATGTATA
rJMSF025K21+ CGGGAGCATAGCGGGCCGGAAATCGGAGTTTGGCAGCCGGATGGACGGCTGGGATGTATA
                      ____________________________________________________________
consensus CGGGAGCATAGCGGGCCGGAAATCGGAGTTTGGCAGCCGGATGGACGGCTGGGATGTATA
 
. : . : . : . : . : . :
rJMSF030G13+ GCTTGTAAAACACCTTCTAACATCAGGTAGTAGCCAGTGGTTGTTAGTAGTATTATTATT
rJMSF029B18+ GCTTGTAAAACACCTTCTAACATCAGGTAGTAGCCAGTGGTTGTTAGTAGTATTATTATT
rJMSF025K21+ GCTTGTAAAACACCTTCTAACATCAGGTAGTAGCCAGTGGTTGTTAGTAGTATTATTATT
                      ____________________________________________________________
consensus GCTTGTAAAACACCTTCTAACATCAGGTAGTAGCCAGTGGTTGTTAGTAGTATTATTATT
 
. : . : . : . : . : . :
rJMSF030G13+ GTTTTCTTGATATTCTTTGTTTTTGGTGGTATAAGTTTTTATGGTCTT
rJMSF029B18+ GTTTTCTTGATATTCTTTGTTTTTGGTGGTATAAGTTTTTATGGTCTTTTAGCCTCTTTG
rJMSF025K21+ GTTTTCTTGATATTCTTTGTTTTTGGTGGTATAAGTTTTTATGGTCTTTTAGCCTCTTTG
                      ____________________________________________________________
consensus GTTTTCTTGATATTCTTTGTTTTTGGTGGTATAAGTTTTTATGGTCTTTTAGCCTCTTTG
 
. : . : . : . : . : . :
rJMSF029B18+ TAGACTCTGCAATTCAATTTGACCTCCTGTTGTGAATTGTGTATT
rJMSF025K21+ TAGACTCTGCAATTCAATTTGACCTCCTGTTGTGAATTGTGTATTTGTGTGTATGGGAGG
                      ____________________________________________________________
consensus TAGACTCTGCAATTCAATTTGACCTCCTGTTGTGAATTGTGTATTTGTGTGTATGGGAGG
 
. : . : . : . : . : . :
rJMSF025K21+ AAGAGTTCAGATGTGGTTGTTGTGCTTCACCAAATATGCATTCCTTAGTCTTCTTTTTAA
                      ____________________________________________________________
consensus AAGAGTTCAGATGTGGTTGTTGTGCTTCACCAAATATGCATTCCTTAGTCTTCTTTTTAA
 
. : . : . : . : . : . :
rJMSF025K21+ AAATTATTCGAGGATGGAAACTTGCAACCACTATCTGATGGTGAATTTGTGATCTTGTGT
                      ____________________________________________________________
consensus AAATTATTCGAGGATGGAAACTTGCAACCACTATCTGATGGTGAATTTGTGATCTTGTGT
 
. : . : . : . : . : . :
rJMSF025K21+ TATACCATGTGGAATCGAATAGGAGAAGTAAATTACACTAGAAGATCTTATGTGATGGAC
                      ____________________________________________________________
consensus TATACCATGTGGAATCGAATAGGAGAAGTAAATTACACTAGAAGATCTTATGTGATGGAC