Previous Contig 012430:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF035E18Sequence502001961 (3)gb:AY568525_16154634e-56Arabidopsis thaliana multidomain cyclophilin type peptidyl-prolyl cis-trans isom658012430 (3)gb:AY568525_16154636e-39Arabidopsis thaliana multidomain cyclophilin type peptidyl-prolyl cis-trans isom
JMFF045P12Sequence633001961 (3)gb:AY568525_16154636e-57Arabidopsis thaliana multidomain cyclophilin type peptidyl-prolyl cis-trans isom649012430 (3)gb:AY568525_16154639e-30Arabidopsis thaliana multidomain cyclophilin type peptidyl-prolyl cis-trans isom
JMSF025K12Sequence646001961 (3)pir|T05314|T053147e-55hypothetical protein F26P21.180 - Arabidopsis thaliana>gb:ATCHRIV78_1547226 Arab741012430 (3)gb:AY568525_16154631e-31Arabidopsis thaliana multidomain cyclophilin type peptidyl-prolyl cis-trans isom

Alignment

This contig is upended


. : . : . : . : . : . :
rJMFF035E18+ TCTGCTGAAGAAAGTGATGGGCAACCAAA
                      ____________________________________________________________
consensus TCTGCTGAAGAAAGTGATGGGCAACCAAA
 
. : . : . : . : . : . :
rJMFF035E18+ AGTTGAAAGATTATTTATAAAGAAGAAAGGAATTGGGTCTGATTCAAAGGCTGAACGCAT
rJMFF045P12+ TGAACGCAT
rJMSF025K12+ TGATTCAAAGGCTGAACGCAT
                      ____________________________________________________________
consensus AGTTGAAAGATTATTTATAAAGAAGAAAGGAATTGGGTCTGATTCAAAGGCTGAACGCAT
 
. : . : . : . : . : . :
rJMFF035E18+ GGCTACAGCAGATGCAGACTTGCAATTACTGACCGGAGCTGAAAGAGAAAGACAACTGTT
rJMFF045P12+ GGCTACAGCAGATGCAGACTTGCAATTACTGACCGGAGCTGAAAGAGAAAGACAACTGTT
rJMSF025K12+ GGCTACAGCAGATGCAGACTTGCAATTACTGACCGGAGCTGAAAGAGAAAGACAACTGTT
                      ____________________________________________________________
consensus GGCTACAGCAGATGCAGACTTGCAATTACTGACCGGAGCTGAAAGAGAAAGACAACTGTT
 
. : . : . : . : . : . :
rJMFF035E18+ GAAACAAAAGAAGCGCAGACGTCATGGACAAGAAGATGAAGTATTAGCAAAGTTGGAAAA
rJMFF045P12+ GAAACAAAAGAAGCGCAGACGTCATGGACAAGAAGATGAAGTATTAGCAAAGTTGGAAAA
rJMSF025K12+ GAAACAAAAGAAGCGCAGACGTCATGGACAAGAAGATGAAGTATTAGCAAAGTTGGAAAA
                      ____________________________________________________________
consensus GAAACAAAAGAAGCGCAGACGTCATGGACAAGAAGATGAAGTATTAGCAAAGTTGGAAAA
 
. : . : . : . : . : . :
rJMFF035E18+ GTTTAAGGCATCAATGTCTAAAAAGCCCAATGGTGAAAATGAAGGAGGAAAGAGCGAGGA
rJMFF045P12+ GTTTAAGGCATCAATGTCTAAAAAGCCCAATGGTGAAAATGAAGGAGGAAAGAGCGAGGA
rJMSF025K12+ GTTTAAGGCATCAATGTCTAAAAAGCCCAATGGTGAAAATGAAGGAGGAAAGAGCGAGGA
                      ____________________________________________________________
consensus GTTTAAGGCATCAATGTCTAAAAAGCCCAATGGTGAAAATGAAGGAGGAAAGAGCGAGGA
 
. : . : . : . : . : . :
rJMFF035E18+ TTTATCTGATTGGGCGTCTGTCAAGCTAAAATTTACTCCTGAGCCTGCAAAGAACAATAT
rJMFF045P12+ TTNATCTGATTGGGCGTCTGTCAAGCTAAAATTTACTCCTGAGCCTGCAAAGAACAATAT
rJMSF025K12+ TTTATCTGATTGGGCGTCTGTCAAGCTAAAATTTACTCCTGAGCCTGCAAAGAACAATAT
                      ____________________________________________________________
consensus TTTATCTGATTGGGCGTCTGTCAAGCTAAAATTTACTCCTGAGCCTGCAAAGAACAATAT
 
. : . : . : . : . : . :
rJMFF035E18+ GTCTCGTAGCAATGACCCTAATGACTATGTGGTGCATGACCCTCTTTGGGAGAAAGGTAA
rJMFF045P12+ GTCTCGTAGCAATGACCCTAATGACTATGTGGTGCATGACCCTCTTTGGGAGAAAGGTAA
rJMSF025K12+ GTCTCGTAGCAATGACCCTAATGACTATGTGGTGCATGACCCTCTTTGGGAGAAAGGTAA
                      ____________________________________________________________
consensus GTCTCGTAGCAATGACCCTAATGACTATGTGGTGCATGACCCTCTTTGGGAGAAAGGTAA
 
. : . : . : . : . : . :
rJMFF035E18+ AGAGAAGTTCAATAAAATGCAAGCGAAGCAGAAGCGCCGAGAACGAGAATGGGCGGGGAA
rJMFF045P12+ AGAGAAGTTCAATAAAATGCAAGCGAAGCAGAAGCGCCGAGAACGAGAATGGGCGGGGAA
rJMSF025K12+ AGAGAAGTTCAATAAAATGCAAGCGAAGCAGAAGCGCCGAGAACGAGAATGGGCGGGGAA
                      ____________________________________________________________
consensus AGAGAAGTTCAATAAAATGCAAGCGAAGCAGAAGCGCCGAGAACGAGAATGGGCGGGGAA
 
. : . : . : . : . : . :
rJMFF035E18+ GTCTATTACCTAAGCTCATATGTCCATACGGGATTTAAACTATGCAAGGAACGAGCGAGC
rJMFF045P12+ GTCTATTACCTAAGCTCATATGTCCATACGGGATTTAAACTATGCAAGGAACGAGCGAGC
rJMSF025K12+ GTCTATTACCTAAGCTCATATGTCCATACGGGATTTAAACTATGCAAGGAACGAGCGAGC
                      ____________________________________________________________
consensus GTCTATTACCTAAGCTCATATGTCCATACGGGATTTAAACTATGCAAGGAACGAGCGAGC
 
. : . : . : . : . : . :
rJMFF035E18+ CAGACTTTAGTATACCTGCCTGCCGCTCAATCACTCATACGGGATGCAGCGCCTCTAGGT
rJMFF045P12+ CAGACTTTAGTATACCTGCCTGCCGCTCAATCACTCATACGGGATGCAGCGCCTCTAGGT
rJMSF025K12+ CAGACTTTAGTATACCTGCCTGCCGCTCAATCACTCATACGGGATGCAACGCCTCTAGGT
                      ____________________________________________________________
consensus CAGACTTTAGTATACCTGCCTGCCGCTCAATCACTCATACGGGATGCAGCGCCTCTAGGT
 
. : . : . : . : . : . :
rJMFF035E18+ AAACTCCTCCTACTGATGAAATTTGCAAGCCATTTTTGTACCAGCAAACATTCTCTCTGC
rJMFF045P12+ AAACTCCTCCTACTGATGAAATTTGCAAGCCATTTTTGTACCAGCAAACATTCTCTCTGC
rJMSF025K12+ AAACTCCTCCTACTGATGAAATTTGCAAGCCATTTTTGTACCAGCAAACATTCTCTCTGC
                      ____________________________________________________________
consensus AAACTCCTCCTACTGATGAAATTTGCAAGCCATTTTTGTACCAGCAAACATTCTCTCTGC
 
. : . : . : . : . : . :
rJMFF035E18+ GCTAAATACATTCCAAACTGATGTAAGAT
rJMFF045P12+ GCTAAATACATTCCAAACTGATGTAAGATTGTCCTGGAAATGTAATTTTACTTTTTACA
rJMSF025K12+ GCTAAATACATTCCAAACTGATGTAAGATTGTCCTGGAAATGTAATTTTACTTTTTACAC
                      ____________________________________________________________
consensus GCTAAATACATTCCAAACTGATGTAAGATTGTCCTGGAAATGTAATTTTACTTTTTACAC
 
. : . : . : . : . : . :
rJMSF025K12+ TCCCTCCCTCTTTATTTAATGGGTTGATTCAGATTTGATTTCTATACCTTTTCTCCGGTT
                      ____________________________________________________________
consensus TCCCTCCCTCTTTATTTAATGGGTTGATTCAGATTTGATTTCTATACCTTTTCTCCGGTT
 
. : . : . : . : . : . :
rJMSF025K12+ GACATACTTAAATATACTGTTGTTTAGGTGCAACCCTTAACTAAAATATACTACCAGAGT
                      ____________________________________________________________
consensus GACATACTTAAATATACTGTTGTTTAGGTGCAACCCTTAACTAAAATATACTACCAGAGT