Previous Contig 012429:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMSF025K08Sequence677012429 (2)pir|T00442|T004428e-87probable rRNA (adenine-N6,N6-)-dimethyltransferase - Arabidopsis thaliana>gb:AC0780012429 (2)pir|T00442|T004423e-64probable rRNA (adenine-N6,N6-)-dimethyltransferase - Arabidopsis thaliana>gb:AC0

Alignment

This contig is upended


. : . : . : . : . : . :
JMSF025K08- GAGAAAGCCGAAA
                      ____________________________________________________________
consensus GAGAAAGCCGAAA
 
. : . : . : . : . : . :
JMSF025K08- GCTAAAAGCTGCTCGTAACCTTCGTAGGGTTTTCTCCACAGAGCGTAGAATTCACCATGG
                      ____________________________________________________________
consensus GCTAAAAGCTGCTCGTAACCTTCGTAGGGTTTTCTCCACAGAGCGTAGAATTCACCATGG
 
. : . : . : . : . : . :
JMSF025K08- CAGGAGGGAAGATACGCAAAGAAAAAACTCACCGTGGCTCCGCCGGAGCTGGCGGCGCAA
                      ____________________________________________________________
consensus CAGGAGGGAAGATACGCAAAGAAAAAACTCACCGTGGCTCCGCCGGAGCTGGCGGCGCAA
 
. : . : . : . : . : . :
JMSF025K08- ACCCTCACTACCAGGGCGGAATTCAATTTCACAAGTCCAAAGGTCAGCACATACTGAAAA
                      ____________________________________________________________
consensus ACCCTCACTACCAGGGCGGAATTCAATTTCACAAGTCCAAAGGTCAGCACATACTGAAAA
 
. : . : . : . : . : . :
JMSF025K08- ATCCTATGTTAGTTGACACAATCGTCGAGAAATCTGGCATCAAACCGACCGATGTCATCC
                      ____________________________________________________________
consensus ATCCTATGTTAGTTGACACAATCGTCGAGAAATCTGGCATCAAACCGACCGATGTCATCC
 
. : . : . : . : . : . :
JMSF025K08- TCGAAATCGGTCCAGGTACTGGTAACTTGACTAAGAAGCTTCTAGAAGCCGGAAAGTCCG
                      ____________________________________________________________
consensus TCGAAATCGGTCCAGGTACTGGTAACTTGACTAAGAAGCTTCTAGAAGCCGGAAAGTCCG
 
. : . : . : . : . : . :
JMSF025K08- TCATAGCTGTCGAGCTTGACCCTCGTATGGTTCTCGAGTTGCAACGGAGATTTCAAGGAA
                      ____________________________________________________________
consensus TCATAGCTGTCGAGCTTGACCCTCGTATGGTTCTCGAGTTGCAACGGAGATTTCAAGGAA
 
. : . : . : . : . : . :
JMSF025K08- CTCCGCCTAGTAAGCTAAAGATTATACAAGGGGATGTTCTCAAGTGTGATCTTCCATACT
                      ____________________________________________________________
consensus CTCCGCCTAGTAAGCTAAAGATTATACAAGGGGATGTTCTCAAGTGTGATCTTCCATACT
 
. : . : . : . : . : . :
JMSF025K08- TTGACATCTGCGTGGCAAATATCCCATACCAAATCTCGTCTCCTCTTACTTTCAAATTAC
                      ____________________________________________________________
consensus TTGACATCTGCGTGGCAAATATCCCATACCAAATCTCGTCTCCTCTTACTTTCAAATTAC
 
. : . : . : . : . : . :
JMSF025K08- TGTCTCATAGGCCACTATTCAGGGCTGCAGTTATTATGTTCCAAAGGGAATTCGCCATGA
rJMSF025K08+ TGTCTCATAGGCCNCTATTCAGGGCTGCAGTTATTATGTTCCAAAGGGAATTCGCCATGA
                      ____________________________________________________________
consensus TGTCTCATAGGCCACTATTCAGGGCTGCAGTTATTATGTTCCAAAGGGAATTCGCCATGA
 
. : . : . : . : . : . :
JMSF025K08- GGCTTGTTGCTCAGCCCGGCGATACTCTTTATTGCCGCCTTTCTGTCAACACTCAACTGT
rJMSF025K08+ GGCTTGTTGCTCAGCCCGGCGATACTCTTTATTGCCGCCTTTCTGTCAACACTCAACTGT
                      ____________________________________________________________
consensus GGCTTGTTGCTCAGCCCGGCGATACTCTTTATTGCCGCCTTTCTGTCAACACTCAACTGT
 
. : . : . : . : . : . :
JMSF025K08- TAGCTCGAGTCTCCCATCTTCTGAAGGTAGGAAGAAACAATTTCAGACCTCCACCCAAGG
rJMSF025K08+ TAGCTCGAGTCTCCCATCTTCTGAAGGTAGGAAGAAACAATTTCAGACCTCCACCCAAGG
                      ____________________________________________________________
consensus TAGCTCGAGTCTCCCATCTTCTGAAGGTAGGAAGAAACAATTTCAGACCTCCACCCAAGG
 
. : . : . : . : . : . :
JMSF025K08- TTGA
rJMSF025K08+ TTGATTCTTCAGTAGTCAGAATTGAGCCAATGAAGCCGTTTCAAAACCTGAACTTCAAGG
                      ____________________________________________________________
consensus TTGATTCTTCAGTAGTCAGAATTGAGCCAATGAAGCCGTTTCAAAACCTGAACTTCAAGG
 
. : . : . : . : . : . :
rJMSF025K08+ AGTGGGATGGTTTAGTTCGAATCTGCTTCAATAGGAAGAACAAAACTCTAGGTGCAATTT
                      ____________________________________________________________
consensus AGTGGGATGGTTTAGTTCGAATCTGCTTCAATAGGAAGAACAAAACTCTAGGTGCAATTT
 
. : . : . : . : . : . :
rJMSF025K08+ TTAGACAAAAGACGGTGCTTTCGTTGCTAGAGAAGAACTACAAAACTCTGCAAGCATTGC
                      ____________________________________________________________
consensus TTAGACAAAAGACGGTGCTTTCGTTGCTAGAGAAGAACTACAAAACTCTGCAAGCATTGC
 
. : . : . : . : . : . :
rJMSF025K08+ AGGTACCCGAGAATGGATCTTTAGAGGACACCACAGACATGTCTTTGGCTGTATCAGCCT
                      ____________________________________________________________
consensus AGGTACCCGAGAATGGATCTTTAGAGGACACCACAGACATGTCTTTGGCTGTATCAGCCT
 
. : . : . : . : . : . :
rJMSF025K08+ TAGGAGATACGCTTGGAGACATGAGTATGGACATCGACGATGGGGATGATGAGAATGAGA
                      ____________________________________________________________
consensus TAGGAGATACGCTTGGAGACATGAGTATGGACATCGACGATGGGGATGATGAGAATGAGA
 
. : . : . : . : . : . :
rJMSF025K08+ TGGATATGGATGATGGTGATGCTAAAGGATCAGATTTCAAAGAAAAAGTTGTGTCAGTGT
                      ____________________________________________________________
consensus TGGATATGGATGATGGTGATGCTAAAGGATCAGATTTCAAAGAAAAAGTTGTGTCAGTGT
 
. : . : . : . : . : . :
rJMSF025K08+ TGAAGCAAGGGAAGTTTGAAGATAAGAGGTCTTCCAAACTCACGCAAGTAGATTTCATGC
                      ____________________________________________________________
consensus TGAAGCAAGGGAAGTTTGAAGATAAGAGGTCTTCCAAACTCACGCAAGTAGATTTCATGC
 
. : . : . : . : . : . :
rJMSF025K08+ ACCTACTTTCTTTGTTCAACAAGGCTGGAATTCACTTTTCTTAGGCATTTTATATCTATA
                      ____________________________________________________________
consensus ACCTACTTTCTTTGTTCAACAAGGCTGGAATTCACTTTTCTTAGGCATTTTATATCTATA
 
. : . : . : . : . : . :
rJMSF025K08+ CATACGGAGTATTTGTTTGTGCGAGGCTCGACTGGATGCATATTTCTTAGCTCAAGCAGC
                      ____________________________________________________________
consensus CATACGGAGTATTTGTTTGTGCGAGGCTCGACTGGATGCATATTTCTTAGCTCAAGCAGC
 
. : . : . : . : . : . :
rJMSF025K08+ TGGTTGGCATTCATCCATTTTGGTCTTCCAATTCAATTTTGGTTCATTACTCAAGGTTTT
                      ____________________________________________________________
consensus TGGTTGGCATTCATCCATTTTGGTCTTCCAATTCAATTTTGGTTCATTACTCAAGGTTTT