Previous Contig 012427:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF027P16Sequence526013486 (4)gb:OSJN00002_16930879e-49Oryza sativa genomic DNA, chromosome 4, BAC clone: OSJNBa0018M05, complete seque581012427 (3)gb:AB005242_15095032e-48Arabidopsis thaliana genomic DNA, chromosome 5, P1 clone:MQK4.>gb:AF503764_18067
JMSF025J24Sequence508013486 (4)gb:OSJN00002_16930873e-41Oryza sativa genomic DNA, chromosome 4, BAC clone: OSJNBa0018M05, complete seque725012427 (3)gb:AB005242_15095039e-76Arabidopsis thaliana genomic DNA, chromosome 5, P1 clone:MQK4.>gb:AF503764_18067
JMSF034B21Sequence631013486 (4)gb:OSJN00002_16930873e-49Oryza sativa genomic DNA, chromosome 4, BAC clone: OSJNBa0018M05, complete seque714012427 (3)gb:AB005242_15095036e-83Arabidopsis thaliana genomic DNA, chromosome 5, P1 clone:MQK4.>gb:AF503764_18067

Alignment

This contig is upended


. : . : . : . : . : . :
rJMSF034B21+ GAACAAATNGAACNAATTTCCGGCCGAGGAAAAAGNGA
rJMSF025J24+ GA
                      ____________________________________________________________
consensus GAACAAATNGAACNAATTTCCGGCCGAGGAAAAAGNGA
 
. : . : . : . : . : . :
rJMSF034B21+ AGCTAAAAGCCAGACAGGGAGTGAGAA-CCATCGCAATGACAGAAGTGGACGTCGTGGAT
rJMSF025J24+ AGCTAAAAGCCAGACAGGGAGTGAGAACCCATCGCAATGACAGAAGTGGACGTCGTGGAT
                      ____________________________________________________________
consensus AGCTAAAAGCCAGACAGGGAGTGAGAACCCATCGCAATGACAGAAGTGGACGTCGTGGAT
 
. : . : . : . : . : . :
rJMSF034B21+ CCCGACACAGGGCGGAGCGTGAAGCGAGACGGGGCGACTCTCGGCGAGGTTGTTTTCAAA
rJMSF025J24+ CCCGACACAGGGCGGAGCGTGAAGCGAGACGGGGCGACTCTCGGCGAGGTTGTTTTCAAA
                      ____________________________________________________________
consensus CCCGACACAGGGCGGAGCGTGAAGCGAGACGGGGCGACTCTCGGCGAGGTTGTTTTCAAA
 
. : . : . : . : . : . :
rJMSF034B21+ GGAGGCTGTATTATGCTAGGATACCTTAAAGACCCAGAAGGGACCGCCAAATGCTTGAAA
rJMSF025J24+ GGAGGCTGTATTATGCTAGGATACCTTAAAGACCCAGAAGGGACCGCCAAATGCTTGAAA
                      ____________________________________________________________
consensus GGAGGCTGTATTATGCTAGGATACCTTAAAGACCCAGAAGGGACCGCCAAATGCTTGAAA
 
. : . : . : . : . : . :
rJMSF034B21+ CCAGACGGGTGGTTTTACACGGGGGACGTCGGGGTGATGCACCCCGAC-GGCTACCTGGA
rJMFF027P16+ GGGGTGATGCACCCCGACGGGCTACCTGGA
rJMSF025J24+ CCAGACGGGTGGTTTTACACGGGGGACGTCGGGGTGATGCACCCCGAC-GGCTACCTGGA
                      ____________________________________________________________
consensus CCAGACGGGTGGTTTTACACGGGGGACGTCGGGGTGATGCACCCCGAC-GGCTACCTGGA
 
. : . : . : . : . : . :
rJMSF034B21+ AATCAAGGACCGGTCAAAGGACGTGATCATCAGCGGCGGGGAGAATCTGAGCAGCGTGGA
rJMFF027P16+ AATCAAGGACCGGTCAAAGGACGTGATCATCAGCGGCGGGGAGAATCTGAGCAGCGTGGA
rJMSF025J24+ AATCAAGGACCGGTCAAAGGACGTGATCATCAGCGGCGGGGAGAATCTGAGCAGCGTGGA
                      ____________________________________________________________
consensus AATCAAGGACCGGTCAAAGGACGTGATCATCAGCGGCGGGGAGAATCTGAGCAGCGTGGA
 
. : . : . : . : . : . :
rJMSF034B21+ GGTAGAGTCGGTGCTGTACATGCACCCGGCGGTGAACGAGGCGGCGGTGGTGGCCCGGCC
rJMFF027P16+ GGTAGAGTCGGTGCTGTACATGCACCCGGCGGTGAACGAGGCGGCGGTGGTGGCCCGGCC
rJMSF025J24+ GGTAGAGTCGGTGCTGTACATGCACCCGGCGGTGAACGAGGCGGCGGTGGTGGCCCGGCC
                      ____________________________________________________________
consensus GGTAGAGTCGGTGCTGTACATGCACCCGGCGGTGAACGAGGCGGCGGTGGTGGCCCGGCC
 
. : . : . : . : . : . :
rJMSF034B21+ GGATGAGTTCTGGGGCGAAACGCCCTGCGCTTTCTTGAGCTTGAAGGCCGGCGTAACCAA
rJMFF027P16+ GGATGAGTTCTGGGGCGAAACGCCCTGCGCTTTCTTGAGCTTGAAGGCCGGCGTAACCAA
rJMSF025J24+ GGATGAGTTCTGGGGCGAAACGCCCTGCGCTTTCTTGAGCTTGAAGGCCGGCGTAACCAA
                      ____________________________________________________________
consensus GGATGAGTTCTGGGGCGAAACGCCCTGCGCTTTCTTGAGCTTGAAGGCCGGCGTAACCAA
 
. : . : . : . : . : . :
rJMSF034B21+ GAAGCCGACGGAGAAAGAAATCATGGAGTTCTGTAGAGCAAGAATGCCGCATTTCATGGT
rJMFF027P16+ GAAGCCGACGGAGAAAGAAATCATGGAGTTCTGTAGAGCAAGAATGCCGCATTTCATGGT
rJMSF025J24+ GAAGCCGACGGAGAAAGAAATCATGGAGTTCTGTAGAGCAAGAATGCCGCATTTCATGGT
                      ____________________________________________________________
consensus GAAGCCGACGGAGAAAGAAATCATGGAGTTCTGTAGAGCAAGAATGCCGCATTTCATGGT
 
. : . : . : . : . : . :
rJMSF034B21+ TCCAAAAACAGTGGTGTTTCAGGATGATCTTCCCAAGACCTCCACCGGGAAGATTCAGAA
rJMFF027P16+ TCCAAAAACAGTGGTGTTTCAGGATGATCTTCCCAAGACCTCCACCGGGAAGATTCAGAA
rJMSF025J24+ TCCAAAAACAGTGGTGTTTCAGGATGATCTTCCCAAGACCTCCACCGGGAAGATTCAGAA
                      ____________________________________________________________
consensus TCCAAAAACAGTGGTGTTTCAGGATGATCTTCCCAAGACCTCCACCGGGAAGATTCAGAA
 
. : . : . : . : . : . :
rJMSF034B21+ GTTCTTGCTCAGGGAGACGGCTAAAGCCATGGGCAGCTCCAAGCTGCAGAGGAAGAGTAG
rJMFF027P16+ GTTCTTGCTCAGGGAGACGGCTAAAGCCATGGGCAGCTCCAAGCTGCAGAGGAAGAGTAG
rJMSF025J24+ GTTCTTGCTCAGGGAGACGGCTAAAGCCATGGGCAGCTCCAAGCTGCAGAGGAAGAGTAG
                      ____________________________________________________________
consensus GTTCTTGCTCAGGGAGACGGCTAAAGCCATGGGCAGCTCCAAGCTGCAGAGGAAGAGTAG
 
. : . : . : . : . : . :
rJMSF034B21+ AATGTAGTTAAATTCAGTATGAATTGAGTGTTCCAAGTTCAAACAACCACGATTGTTTCC
rJMFF027P16+ AATGTAGTTAAATTCAGTATGAATTGAGTGTTCCAAGTTCAAACAACCACGATTGTTTCC
rJMSF025J24+ AATGTAGTTAAATTCAGTATGAATTGAGTGTTCCAAGTTCAAACAACCACGATTGTTTCC
                      ____________________________________________________________
consensus AATGTAGTTAAATTCAGTATGAATTGAGTGTTCCAAGTTCAAACAACCACGATTGTTTCC
 
. : . : . : . : . : . :
rJMSF034B21+ TTTCAATTAATAAGCCAA
rJMFF027P16+ TTTCAATTAATAAGCCAATTGTTATCAAATAAAACACATT
rJMSF025J24+ TTTCAATTAATAAGCCAATTGTTATCAAATAAAACACATTTGTGAGATGTTTAAAGCAAT
                      ____________________________________________________________
consensus TTTCAATTAATAAGCCAATTGTTATCAAATAAAACACATTTGTGAGATGTTTAAAGCAAT