Previous Contig 012425:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFN028A09Sequence637012425 (3)gb:AK117749_18157664e-73Arabidopsis thaliana At5g43500 mRNA for putative actin, complete cds, clone: RAF
JMSF002G19Sequence389004418 (3)gb:CQ760250_14516752e-23Sequence 17 from Patent WO2004003013.>gb:AB025638_1516679 Arabidopsis thaliana g164012425 (3)gb:AK117749_18157663e-12Arabidopsis thaliana At5g43500 mRNA for putative actin, complete cds, clone: RAF
JMSF025J17Sequence649004418 (3)gb:CQ760250_14516751e-36Sequence 17 from Patent WO2004003013.>gb:AB025638_1516679 Arabidopsis thaliana g790012425 (3)gb:AK117749_18157665e-85Arabidopsis thaliana At5g43500 mRNA for putative actin, complete cds, clone: RAF

Alignment

This contig is upended


. : . : . : . : . : . :
JMFN028A09- TCCAATCCGCAGAGGTCACCTTAATATT
                      ____________________________________________________________
consensus TCCAATCCGCAGAGGTCACCTTAATATT
 
. : . : . : . : . : . :
JMFN028A09- TCTCAACATTACTCGATGCAGCAGGTTCTTGAGGACCTGCAAACTATCTGGGATTGGATT
                      ____________________________________________________________
consensus TCTCAACATTACTCGATGCAGCAGGTTCTTGAGGACCTGCAAACTATCTGGGATTGGATT
 
. : . : . : . : . : . :
JMFN028A09- TTGACTGAGAAACTGAATATCCCTCAGCATCTAAGACATATGTATGCTGCTATTCTTGTT
                      ____________________________________________________________
consensus TTGACTGAGAAACTGAATATCCCTCAGCATCTAAGACATATGTATGCTGCTATTCTTGTT
 
. : . : . : . : . : . :
JMFN028A09- GTTCCAGAGACATTTGATAATCGAGAAATAAAAGAAATGATATCTATTGTTTTACGGGAC
                      ____________________________________________________________
consensus GTTCCAGAGACATTTGATAATCGAGAAATAAAAGAAATGATATCTATTGTTTTACGGGAC
 
. : . : . : . : . : . :
JMFN028A09- TTGCAGTTCAGTTTGACAGTTGTCCACCAGGAAGGCCTTGCTGCAATATTTGGTAATGGT
                      ____________________________________________________________
consensus TTGCAGTTCAGTTTGACAGTTGTCCACCAGGAAGGCCTTGCTGCAATATTTGGTAATGGT
 
. : . : . : . : . : . :
JMFN028A09- TTGCCAACAGCATGTATTGTGAATATGGGTGCTCAGGTGACATCTGTTATTTGCGTTGAG
                      ____________________________________________________________
consensus TTGCCAACAGCATGTATTGTGAATATGGGTGCTCAGGTGACATCTGTTATTTGCGTTGAG
 
. : . : . : . : . : . :
JMFN028A09- GATGGAGTAGCTTTACCTTCGACACTGATTAGTCTACGTTACGGTGGAGAGGATATATCA
                      ____________________________________________________________
consensus GATGGAGTAGCTTTACCTTCGACACTGATTAGTCTACGTTACGGTGGAGAGGATATATCA
 
. : . : . : . : . : . :
JMFN028A09- AGGTGCCTTCTCTGGACTCAGAGACATCATCAAACTTGGCCACCAATTCGTACTGATGCT
                      ____________________________________________________________
consensus AGGTGCCTTCTCTGGACTCAGAGACATCATCAAACTTGGCCACCAATTCGTACTGATGCT
 
. : . : . : . : . : . :
rJMSF002G19+ TTTACAAAGCCTGTAGATTTATTAACGCTGAACAAACTTAAAGAGTCCTATTGTATGATC
JMFN028A09- TTTACAAAGCCTGTAGATTTATTAACGCTGAACAAACTTAAAGAGTCCTATTGTATGATC
rJMSF025J17+ TTTACNAAGCCTGTAGA-TTATTAACGCTGAACAAACTTAAAGAGTCCTATTGTATGATC
                      ____________________________________________________________
consensus TTTACAAAGCCTGTAGATTTATTAACGCTGAACAAACTTAAAGAGTCCTATTGTATGATC
 
. : . : . : . : . : . :
rJMSF002G19+ AGAGAGGGAGAGGTTGAAGCGGTTGCTCAGGTTCATTCATATGAAGATGGCATGGTACCT
JMFN028A09- AGAGAGGGAGAGGTTGAAGCGGTTGCTCAGGTTCATTCATATGAAGATGGCATGGTACCT
rJMSF025J17+ AGAGAGGGAGAGGTTGAAGCGGTTGCTCAGGTTCATTCATATGAAGATGGCATGGTACCT
                      ____________________________________________________________
consensus AGAGAGGGAGAGGTTGAAGCGGTTGCTCAGGTTCATTCATATGAAGATGGCATGGTACCT
 
. : . : . : . : . : . :
rJMSF002G19+ GGATCACACAAGTCAAGGCTAACCGCTCTTAATGTA
JMFN028A09- GGATCACACAAGTCAAGGCTAACCGCTCTTAATGTACCNCC-ATGGGTTTATTNTATCCA
rJMSF025J17+ GGATCACACAAGTCAAGGCTAACCGCTCTTAATGTACCCCCAATGGGTTTATTTTATCCA
                      ____________________________________________________________
consensus GGATCACACAAGTCAAGGCTAACCGCTCTTAATGTACCCCCAATGGGTTTATTTTATCCA
 
. : . : . : . : . : . :
JMFN028A09- ACACTTTTGG
rJMSF025J17+ ACACTTTTGGTCCCGGATGTGTATCCTCCCCCTCCTCGTTCTTGGTTTAATGACTATGAT
                      ____________________________________________________________
consensus ACACTTTTGGTCCCGGATGTGTATCCTCCCCCTCCTCGTTCTTGGTTTAATGACTATGAT
 
. : . : . : . : . : . :
rJMSF025J17+ GATATGCTTGAAGATACATGGCATATGGACTTTCCTGGCACCGGTGCATTTCCGATGTGG
                      ____________________________________________________________
consensus GATATGCTTGAAGATACATGGCATATGGACTTTCCTGGCACCGGTGCATTTCCGATGTGG
 
. : . : . : . : . : . :
rJMSF025J17+ GAGAGCTATCCAATTTTTCAATCCAAACCGAAGAGAGAAGATAATATTGGTCTTGCAGAA
                      ____________________________________________________________
consensus GAGAGCTATCCAATTTTTCAATCCAAACCGAAGAGAGAAGATAATATTGGTCTTGCAGAA
 
. : . : . : . : . : . :
rJMSF025J17+ GCTATTGCGAAAAGCATTCTTTCAACAGCACGCATTGATCTCCAAAGAAAGCTGTTTTGT
                      ____________________________________________________________
consensus GCTATTGCGAAAAGCATTCTTTCAACAGCACGCATTGATCTCCAAAGAAAGCTGTTTTGT
 
. : . : . : . : . : . :
rJMSF025J17+ AGTATGCAACTGATTGGTGGAGTTGCATTGACTGACGGCCTTATTCCTGCCGTCGAGGAA
                      ____________________________________________________________
consensus AGTATGCAACTGATTGGTGGAGTTGCATTGACTGACGGCCTTATTCCTGCCGTCGAGGAA
 
. : . : . : . : . : . :
rJMSF025J17+ AGAGTTTTACACGCGATTCCTTCACATGAAGCAATTGACACAGTCGAGGTATTGCAGTCT
                      ____________________________________________________________
consensus AGAGTTTTACACGCGATTCCTTCACATGAAGCAATTGACACAGTCGAGGTATTGCAGTCT
 
. : . : . : . : . : . :
rJMSF025J17+ AGAACAAACCCCGCTTTTGTATCATGGAAAGGTGGAGCAGTTCTAGGCATTCTCGATTTC
                      ____________________________________________________________
consensus AGAACAAACCCCGCTTTTGTATCATGGAAAGGTGGAGCAGTTCTAGGCATTCTCGATTTC
 
. : . : . : . : . : . :
rJMSF025J17+ ACTCGAGACGGCTGGATTAGTCGAGAGGACTGGATCAGAAGCGGGATCGACACAAGAATC
                      ____________________________________________________________
consensus ACTCGAGACGGCTGGATTAGTCGAGAGGACTGGATCAGAAGCGGGATCGACACAAGAATC
 
. : . : . : . : . : . :
rJMSF025J17+ AGGAGGAAATACAAGGATTCTTATTATCTTCAGGCACATACAATGGCGTACATAAATTCA
                      ____________________________________________________________
consensus AGGAGGAAATACAAGGATTCTTATTATCTTCAGGCACATACAATGGCGTACATAAATTCA
 
. : . : . : . : . : . :
rJMSF025J17+ TAGCCTAGTTGCAATACTTTCATTGTACTTTCAGTTCCAACGAAGACTCATTATATATTA
                      ____________________________________________________________
consensus TAGCCTAGTTGCAATACTTTCATTGTACTTTCAGTTCCAACGAAGACTCATTATATATTA