Previous Contig 012411:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMSF025G14Sequence640012411 (2)gb:AP001633_18213775e-35Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, PAC clone:P051767012411 (2)gb:AP001633_18213771e-64Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, PAC clone:P051

Alignment

This contig is upended


. : . : . : . : . : . :
JMSF025G14- TGAGGACGATTTTGGGTATTAACTCGTTATTTTTCTATCCAACAT
                      ____________________________________________________________
consensus TGAGGACGATTTTGGGTATTAACTCGTTATTTTTCTATCCAACAT
 
. : . : . : . : . : . :
JMSF025G14- TCAAATTCCCTTTTAGTTCTTATTCTTCCAAAAAGCTGAACCCCAATCCTAAGGGCTCCG
                      ____________________________________________________________
consensus TCAAATTCCCTTTTAGTTCTTATTCTTCCAAAAAGCTGAACCCCAATCCTAAGGGCTCCG
 
. : . : . : . : . : . :
JMSF025G14- CACCCTGACCCGACAGAATATTTGGGAAGATGTAAATCATGGTAACTCAACTGAACATGA
                      ____________________________________________________________
consensus CACCCTGACCCGACAGAATATTTGGGAAGATGTAAATCATGGTAACTCAACTGAACATGA
 
. : . : . : . : . : . :
JMSF025G14- ACCAAAGAGGCTAGACCTTATGATAAAGTCGAAAAAAATGTTATAAATTTCTATATTTAA
                      ____________________________________________________________
consensus ACCAAAGAGGCTAGACCTTATGATAAAGTCGAAAAAAATGTTATAAATTTCTATATTTAA
 
. : . : . : . : . : . :
JMSF025G14- CAACAAATTGTGAAAATTATGATGAAGTCGAGAAAAATGTTACAAATTTATGTATTTAAT
rJMSF025G14+ AAATTATGATGNAGTCGAGAAAAATGTTACAAATTTANGTATTTAAT
                      ____________________________________________________________
consensus CAACAAATTGTGAAAATTATGATGAAGTCGAGAAAAATGTTACAAATTTATGTATTTAAT
 
. : . : . : . : . : . :
JMSF025G14- TATTTATGGAACAGATTGTGCAAATTATTTCAAGAAATCATTGTTTCTGGTGGGTGAGAT
rJMSF025G14+ TATTTATGGAACAGATTGTGCAAATTATTTCAAGAAATCATTGTTTCTGGTGGGTGAGAT
                      ____________________________________________________________
consensus TATTTATGGAACAGATTGTGCAAATTATTTCAAGAAATCATTGTTTCTGGTGGGTGAGAT
 
. : . : . : . : . : . :
JMSF025G14- CGGAGGAAATGACTACAACTACCCTTTCTTTGTCGGTGCAACCCTAGAACAGCTTAAAGC
rJMSF025G14+ CGGAGGAAATGACTACAACTACCCTTTCTTTGTCGGTGCAACCCTAGAACAGCTTAAAGC
                      ____________________________________________________________
consensus CGGAGGAAATGACTACAACTACCCTTTCTTTGTCGGTGCAACCCTAGAACAGCTTAAAGC
 
. : . : . : . : . : . :
JMSF025G14- AGCAGTGCCGTTTGTAGTTGGAGCCATTATTGAAGCAACAAGAGGTTTAATAAAGGAAGG
rJMSF025G14+ AGCAGTGCCGTTTGTAGTTGGAGCCATTATTGAAGCAACAAGAGGTTTAATAAAGGAAGG
                      ____________________________________________________________
consensus AGCAGTGCCGTTTGTAGTTGGAGCCATTATTGAAGCAACAAGAGGTTTAATAAAGGAAGG
 
. : . : . : . : . : . :
JMSF025G14- AGCCGTAGAATTAGTTGTGCCTGGGAATTTGCCGATTGGTTGTTCCGCGGTGTACCTCAC
rJMSF025G14+ AGCCGTAGAATTAGTTGTGCCTGGGAATTTGCCGATTGGTTGTTCCGCGGTGTACCTCAC
                      ____________________________________________________________
consensus AGCCGTAGAATTAGTTGTGCCTGGGAATTTGCCGATTGGTTGTTCCGCGGTGTACCTCAC
 
. : . : . : . : . : . :
JMSF025G14- TCTCTTTGGAACTCCAAACAAATCAGCGTACGACCAAAATGGTTGTTTGAAAGTATACAA
rJMSF025G14+ TCTCTTTGGAACTCCAAACAAATCAGCGTACGACCAAAATGGTTGTTTGAAAGTATACAA
                      ____________________________________________________________
consensus TCTCTTTGGAACTCCAAACAAATCAGCGTACGACCAAAATGGTTGTTTGAAAGTATACAA
 
. : . : . : . : . : . :
JMSF025G14- TGATTTCTCCAAGTATCACAATTCTCAGCTCCGGTTTGCATTGGGGAAGCTAAGG
rJMSF025G14+ TGATTTCTCCAAGTATCACAATTCTCAGCTCCGGTTTGCATTGGGGAAGCTAAGGAAAGA
                      ____________________________________________________________
consensus TGATTTCTCCAAGTATCACAATTCTCAGCTCCGGTTTGCATTGGGGAAGCTAAGGAAAGA
 
. : . : . : . : . : . :
rJMSF025G14+ GTACCCTCATGCTAAGATCATCTACGCCGACTATTATGCTGCTGCCAAGAGATTTTTTCA
                      ____________________________________________________________
consensus GTACCCTCATGCTAAGATCATCTACGCCGACTATTATGCTGCTGCCAAGAGATTTTTTCA
 
. : . : . : . : . : . :
rJMSF025G14+ TTCTCCCAAACATTACGGGTTTTACGATGGGGTTTTAGCCGCCTGCTGCGGCGGCGGAGG
                      ____________________________________________________________
consensus TTCTCCCAAACATTACGGGTTTTACGATGGGGTTTTAGCCGCCTGCTGCGGCGGCGGAGG
 
. : . : . : . : . : . :
rJMSF025G14+ GCCGTACAACTTCAACAACTCGGCGAGGTGTGGACACGTGGGATCAAAAGCTTGTGGGAA
                      ____________________________________________________________
consensus GCCGTACAACTTCAACAACTCGGCGAGGTGTGGACACGTGGGATCAAAAGCTTGTGGGAA
 
. : . : . : . : . : . :
rJMSF025G14+ CCCGTCGGCGTTTGCAAACTGGGATGGGATTCACTTGACGGAAGCTGCTTATAGGCTCAT
                      ____________________________________________________________
consensus CCCGTCGGCGTTTGCAAACTGGGATGGGATTCACTTGACGGAAGCTGCTTATAGGCTCAT
 
. : . : . : . : . : . :
rJMSF025G14+ TGCCAAGGCCTTATTGATCACCGGCCCCTTCCAATTCACTTCTCCGCCTCTCACTTTCTC
                      ____________________________________________________________
consensus TGCCAAGGCCTTATTGATCACCGGCCCCTTCCAATTCACTTCTCCGCCTCTCACTTTCTC
 
. : . : . : . : . : . :
rJMSF025G14+ CCCCATTAATGCTTTTTAGTTTCTTTCATTTTCAATTCTCTCCTCCCTTAATTAGCTTTT
                      ____________________________________________________________
consensus CCCCATTAATGCTTTTTAGTTTCTTTCATTTTCAATTCTCTCCTCCCTTAATTAGCTTTT