Previous Contig 012409:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF012N16Sequence602012409 (6)gb:AB019232_15141842e-63Arabidopsis thaliana genomic DNA, chromosome 3, P1 clone: MIL23.>gb:ATH224640_15710012409 (6)gb:AY093009_15749636e-80Arabidopsis thaliana FKBP-type peptidyl-prolyl cis-trans isomerases, putative (A
JMSF007E22Sequence356012409 (6)gb:AY093009_15749638e-06Arabidopsis thaliana FKBP-type peptidyl-prolyl cis-trans isomerases, putative (A801012409 (6)gb:AY093009_15749632e-92Arabidopsis thaliana FKBP-type peptidyl-prolyl cis-trans isomerases, putative (A
JMSF025F19Sequence654012409 (6)gb:AB019232_15141841e-73Arabidopsis thaliana genomic DNA, chromosome 3, P1 clone: MIL23.>gb:ATH224640_15796012409 (6)gb:AY093009_15749632e-85Arabidopsis thaliana FKBP-type peptidyl-prolyl cis-trans isomerases, putative (A

Alignment

This contig is upended


. : . : . : . : . : . :
JMSF007E22- GGCAC
                      ____________________________________________________________
consensus GGCAC
 
. : . : . : . : . : . :
JMSF007E22- CGTTAAGCGAAACTGCGATTTTGGCTGCTCGGCAACGGCGACGACCGAAGCTCTCTCTTC
                      ____________________________________________________________
consensus CGTTAAGCGAAACTGCGATTTTGGCTGCTCGGCAACGGCGACGACCGAAGCTCTCTCTTC
 
. : . : . : . : . : . :
JMSF007E22- TCTCACTGCTTAGCTTGGCGACGCTCTCTCCGTGACGTCTGGCAATTTGGCAGAGTTGTT
JMFF012N16- GTTGTT
JMSF025F19- GTTGTT
                      ____________________________________________________________
consensus TCTCACTGCTTAGCTTGGCGACGCTCTCTCCGTGACGTCTGGCAATTTGGCAGAGTTGTT
 
. : . : . : . : . : . :
JMSF007E22- GACTGGTTAGCTGAAAACCGCACCGGGAGGGCAAAAGGTCAGGAAATTTGAATAATGGCT
JMFF012N16- GACTGGTTAGCTGAAAACCGCACCGGGGGGGCAAAAGGTCAGGAAATTTGAATAATGGCT
JMSF025F19- GACTGGTTAGCTGAAAACCGCACCGGGAGGGCAAAAGGTCAGGAAATTTGAATAATGGCT
                      ____________________________________________________________
consensus GACTGGTTAGCTGAAAACCGCACCGGGAGGGCAAAAGGTCAGGAAATTTGAATAATGGCT
 
. : . : . : . : . : . :
JMSF007E22- GTTGTAGAGGAGGAACATAAGCAGCAACAGACCTCGCAGATTGATCAAAATGCTGTTGAT
JMFF012N16- GTTGTAGAGGAGGAACATAAGCAGCAACAGACCTCGCAGATTGATCAAAATGCTGTTGAT
JMSF025F19- GTTGTAGAGGAGGAACATAAGCAGCAACAGACCTCGCAGATTGATCAAAATGCTGTTGAT
                      ____________________________________________________________
consensus GTTGTAGAGGAGGAACATAAGCAGCAACAGACCTCGCAGATTGATCAAAATGCTGTTGAT
 
. : . : . : . : . : . :
JMSF007E22- GAAATCATCACTGAAGGAACTTCAGTTGTTCATGGAGAGCTCCCTCAAGATGATGGTCCA
JMFF012N16- GAAATCATCACTGAAGGAACTTCAGTTGTTCATGGAGAGCTCCCTCAAGATGATGGTCCA
JMSF025F19- GAAATCATCACTGAAGGAACTTCAGTTGTTCATGGAGAGCTCCCTCAAGATGATGGTCCA
                      ____________________________________________________________
consensus GAAATCATCACTGAAGGAACTTCAGTTGTTCATGGAGAGCTCCCTCAAGATGATGGTCCA
 
. : . : . : . : . : . :
JMSF007E22- CCAAAAGTTGATTCAGCAATGGAAGTTCTCCACGAGAAAGTAACAAAGCAA
JMFF012N16- CCAAAAGTTGATTCAGCAATGGAAGTTCTCCACGAGAAAGTAACAAAGCAAATTATTAAA
JMSF025F19- CCAAAAGTTGATTCAGCAATGGAAGTTCTCCACGAGAAAGTAACAAAGCAAATTATTAAA
                      ____________________________________________________________
consensus CCAAAAGTTGATTCAGCAATGGAAGTTCTCCACGAGAAAGTAACAAAGCAAATTATTAAA
 
. : . : . : . : . : . :
JMFF012N16- GAGGGCCATGGTCAGAAGCCATCAAAATATGCAACATGCTTTTTGCATTATAGGGCATGG
JMSF025F19- GAGGGCCATGGTCAGAAGCCATCAAAATATGCAACATGCTTTTTGCATTATAGGGCATGG
                      ____________________________________________________________
consensus GAGGGCCATGGTCAGAAGCCATCAAAATATGCAACATGCTTTTTGCATTATAGGGCATGG
 
. : . : . : . : . : . :
JMFF012N16- GCAGAAAGCACCCAACACAAGTTTGAAGACACATGGCATGAACAACAACCCCTTGAGTTG
JMSF025F19- GCAGAAAGCACCCAACACAAGTTTGAAGACACATGGCATGAACAACAACCCCTTGAGTTG
                      ____________________________________________________________
consensus GCAGAAAGCACCCAACACAAGTTTGAAGACACATGGCATGAACAACAACCCCTTGAGTTG
 
. : . : . : . : . : . :
JMFF012N16- GTAATTGGAAAAGAGAAAAAGGAAATGACTGGGCTAGCTATTGGCATTTCTGGCATGAGA
JMSF025F19- GTAATTGGAAAAGAGAAAAAGGAAATGACTGGGCTAGCTATTGGCATTTCTGGCATGAGA
                      ____________________________________________________________
consensus GTAATTGGAAAAGAGAAAAAGGAAATGACTGGGCTAGCTATTGGCATTTCTGGCATGAGA
 
. : . : . : . : . : . :
JMFF012N16- TCTGGTGAACGTGCATTGCTACATGTCGGATGGGAACTAGCCTATGGAAAAGATGGAAGC
JMSF025F19- TCTGGTGAACGTGCATTGCTACATGTCGGATGGGAACTAGCCTATGGAAAAGATGGAAGC
rJMSF007E22+ TCGGATGGGAACTAGCCTATGGAAAAGATGGAAGC
rJMSF025F19+ TATGGAAAAGATGG-AGC
                      ____________________________________________________________
consensus TCTGGTGAACGTGCATTGCTACATGTCGGATGGGAACTAGCCTATGGAAAAGATGGAAGC
 
. : . : . : . : . : . :
JMFF012N16- TTCTCATTTCCAAATGTTGCACCCATGGCCAATGTTATATATGAAGTTGAATTAATTGGT
JMSF025F19- TTCTCATTTCCAAATGTTGCACCCATGGCCAATGTTATATATGAAGTTGAATTAATTGGT
rJMFF012N16+ AATGTTATATATGAAGTTGAATTAATTGGT
rJMSF007E22+ TTCTCATTTCCAAATGTTGCACCCATGGCCAATGTTATATATGAAGTTGAATTAATTGGT
rJMSF025F19+ TTCTCANTTCCAAATGTTGCACCCATGGCCAATGTTATATATGAAGTTGAATTAATTGGT
                      ____________________________________________________________
consensus TTCTCATTTCCAAATGTTGCACCCATGGCCAATGTTATATATGAAGTTGAATTAATTGGT
 
. : . : . : . : . : . :
JMFF012N16- TTTGATGAAACCA
JMSF025F19- TTTGATGAAACCAAAGAAGGCAAAGCGCGAGGTGACATGACAGTAGAAGAGCGAATTGGT
rJMFF012N16+ TTTGATGAAACCAAAGAAGGCAAAGCGCGAGGTGACATGACAGTAGAAGAGCGAATTGGT
rJMSF007E22+ TTTGATGAAACCAAAGAAGGCAAAGCGCGAGGTGACATGACAGTAGAAGAGCGAATTGGT
rJMSF025F19+ TTTGATGAAACCAAAGAAGGCAAAGCGCGAGGTGACATGACAGTAGAAGAGCGAATTGGT
                      ____________________________________________________________
consensus TTTGATGAAACCAAAGAAGGCAAAGCGCGAGGTGACATGACAGTAGAAGAGCGAATTGGT
 
. : . : . : . : . : . :
JMSF025F19- GCTGCTGATA
rJMFF012N16+ GCTGCTGATAGGAGAAAGATGAATGGAAATGTTTTATTCAAGGAAGAAAAACTTGAGGAG
rJMSF007E22+ GCTGCTGATAGGAGAAAGATGAATGGAAATGCTTTATTCAAGGAAGAAAAACTTGAGGAG
rJMSF025F19+ GCTGCTGATAGGAGAAAGATGAATGGAAATGCTTTATTCAAGGAAGAAAAACTTGAGGAG
                      ____________________________________________________________
consensus GCTGCTGATAGGAGAAAGATGAATGGAAATGCTTTATTCAAGGAAGAAAAACTTGAGGAG
 
. : . : . : . : . : . :
rJMFF012N16+ GCAATGAAACAGTATGAAATGGCCATAGCATATATGGGAGACGACTTCATGTTCCAGTTG
rJMSF007E22+ GCAATGAAACAGTATGAAATGGCCATAGCATATATGGGAGACGACTTCATGTTCCAGTTG
rJMSF025F19+ GCAATGAAACAGTATGAAATGGCCATAGCATATATGGGAGACGACTTCATGTTCCAGTTG
                      ____________________________________________________________
consensus GCAATGAAACAGTATGAAATGGCCATAGCATATATGGGAGACGACTTCATGTTCCAGTTG
 
. : . : . : . : . : . :
rJMFF012N16+ TTTGGTAAATACCGTGACATGGCTTTAGCTGTAAAGAATCCTTGCCACCTTAACATGGCA
rJMSF007E22+ TTTGGTAAATACCGTGACATGGCTTTAGCTGTAAAGAATCCTTGCCACCTTAACATGGCA
rJMSF025F19+ TTTGGTAAATACCGTGACATGGCTTTAGCTGTAAAGAATCCTTGCCACCTTAACATGGCA
                      ____________________________________________________________
consensus TTTGGTAAATACCGTGACATGGCTTTAGCTGTAAAGAATCCTTGCCACCTTAACATGGCA
 
. : . : . : . : . : . :
rJMFF012N16+ GCATGCTTGTTGAAGCTCAACCGCTATGATGAAGCCATAGCACAATGTAGCATTGTGTTG
rJMSF007E22+ GCATGCTTGTTGAAGCTCAACCGCTATGATGAAGCCATAGCACAATGTAGCATTGTGTTG
rJMSF025F19+ GCATGCTTGTTGAAGCTCAACCGCTATGATGAAGCCATAGCACAATGTAGCATTGTGTTG
                      ____________________________________________________________
consensus GCATGCTTGTTGAAGCTCAACCGCTATGATGAAGCCATAGCACAATGTAGCATTGTGTTG
 
. : . : . : . : . : . :
rJMFF012N16+ GTTGAGGATGAAAACAATGTTAAAGCATTATTCAGAAGAGGAAAGGCTAGAGCAGAGCTT
rJMSF007E22+ GTTGAGGATGAAAACAATGTTAAAGCATTATTCAGAAGAGGAAAGGCTAGAGCAGAGCTT
rJMSF025F19+ GTTGAGGATGAAAACAATGTTAAAGCATTATTCAGAAGAGGAAAGGCTAGAGCAGAGCTT
                      ____________________________________________________________
consensus GTTGAGGATGAAAACAATGTTAAAGCATTATTCAGAAGAGGAAAGGCTAGAGCAGAGCTT
 
. : . : . : . : . : . :
rJMFF012N16+ GGGCAAACAGACGCAGCTCGTGAAGACTTCCTTAAAGCACGCAAGTTTGCCCCTCAAGAC
rJMSF007E22+ GGGCAAACAGACGCAGCTCGTGAAGACTTCCTTAAAGCACGCAAGTTTGCCCCTCAAGAC
rJMSF025F19+ GGGCAAACAGACGCAGCTCGTGAAGACTTCCTTAAAGCACGCAAGTTTGCCCCTCAAGAC
                      ____________________________________________________________
consensus GGGCAAACAGACGCAGCTCGTGAAGACTTCCTTAAAGCACGCAAGTTTGCCCCTCAAGAC
 
. : . : . : . : . : . :
rJMFF012N16+ AAAGCCATTGCACAGGAATTGCGTTTACTCGCTGAATATGACAAGGCTGTCTATCAAAAA
rJMSF007E22+ AAAGCCATTGCACAGGAATTGCGTTTACTCGCTGAATATGACAAGGCTGTCTATCAAAAA
rJMSF025F19+ AAAGCCATTGCACAGGAATTGCGTTTACTCGCTGAATATGACAAGGCTGTCTATCAAAAA
                      ____________________________________________________________
consensus AAAGCCATTGCACAGGAATTGCGTTTACTCGCTGAATATGACAAGGCTGTCTATCAAAAA
 
. : . : . : . : . : . :
rJMFF012N16+ CAAAAGGAACTCTACAAAGGTTTATTTGGAAAAAGCCCCGAGGCCAAACCCGAGAAGAAG
rJMSF007E22+ CAAAAGGAACTCTACAAAGGTTTATTTGGAAAAAGCCCCGAGGCCAAACCCGAGAAGAAG
rJMSF025F19+ CAAAAGGAACTCTACAAAGGTTTATTTGGAAAAAGCCCCGAGGCCAAACCCGAGAAGAAG
                      ____________________________________________________________
consensus CAAAAGGAACTCTACAAAGGTTTATTTGGAAAAAGCCCCGAGGCCAAACCCGAGAAGAAG
 
. : . : . : . : . : . :
rJMFF012N16+ AGTTTACTACTTGTGATTTGGCATTGGCTGTTGTCTCTGTTCTATTATTTCTTCAGGCGC
rJMSF007E22+ AGTTTACTACTTGTGATTTGGCATTGGCTGTTGTCTCTGTTCTATTATTTCTTCAGGCGC
rJMSF025F19+ AGTTTACTACTTGTGATTTGGCATTGGCTGTTGTCTCTGTTCTATTATTTCTTCAGGCGC
                      ____________________________________________________________
consensus AGTTTACTACTTGTGATTTGGCATTGGCTGTTGTCTCTGTTCTATTATTTCTTCAGGCGC
 
. : . : . : . : . : . :
rJMFF012N16+ AAAGCGGGTAAAACCGACTAAACTGTTGAACCCGGTCTGAATTTTCACCTAAGCTGTAGT
rJMSF007E22+ AAAGCGGGTAAAACCGACTAAACTGTTGAACCCGGTCTGAATTTTCACCTAAGCTGTAGT
rJMSF025F19+ AAAGCGGGTAAAACCGACTAAACTGTTGAACCCGGTCTGAATTTTCACCTAAGCTGTAGT
                      ____________________________________________________________
consensus AAAGCGGGTAAAACCGACTAAACTGTTGAACCCGGTCTGAATTTTCACCTAAGCTGTAGT
 
. : . : . : . : . : . :
rJMFF012N16+ GCCATGTATGCATTTCTACC
rJMSF007E22+ G-CATGTATGCATTTCTACCTATCTTTGATTTTGGTTATTGTAGTTT
rJMSF025F19+ G-CATGTATGCATTTCTACCTATCTTTGATTTTGGTTATTGTAGTTTTGACTACTAAGTG
                      ____________________________________________________________
consensus G-CATGTATGCATTTCTACCTATCTTTGATTTTGGTTATTGTAGTTTTGACTACTAAGTG