Previous Contig 012402:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMSF025E20Sequence684006282 (2)pir|G86284|G862842e-26F9L1.4 protein - Arabidopsis thaliana>gb:AE005172_890507 Arabidopsis thaliana ch784012402 (2)gb:AC093956_1736197e-102Oryza sativa (japonica cultivar-group) chromosome 5 clone OJ1263_E10, complete s
JMSF025M21Sequence627006282 (2)pir|G86284|G862841e-16F9L1.4 protein - Arabidopsis thaliana>gb:AE005172_890507 Arabidopsis thaliana ch727012402 (2)gb:AC093956_17361974e-89Oryza sativa (japonica cultivar-group) chromosome 5 clone OJ1263_E10, complete s

Alignment

This contig is upended


. : . : . : . : . : . :
rJMSF025E20+ TCAA
                      ____________________________________________________________
consensus TCAA
 
. : . : . : . : . : . :
rJMSF025M21+ TGGTATTTG
rJMSF025E20+ CGAGTGCTGGTGGGACAGCATTGTTCTTGACATATTAATCTGCAATTGGTTTGGTATTTG
                      ____________________________________________________________
consensus CGAGTGCTGGTGGGACAGCATTGTTCTTGACATATTAATCTGCAATTGGTTTGGTATTTG
 
. : . : . : . : . : . :
rJMSF025M21+ GGCAGGGATGCGTACTGTTCGTTATTTTGATGGTAGAACATATGAGTGGGTTGGTATCAG
rJMSF025E20+ GGCAGGGATGCGTACTGTTCGTTATTTTGATGGTAGAACATATGAGTGGGTTGGTATCAG
                      ____________________________________________________________
consensus GGCAGGGATGCGTACTGTTCGTTATTTTGATGGTAGAACATATGAGTGGGTTGGTATCAG
 
. : . : . : . : . : . :
rJMSF025M21+ CCGACAACCAAATATTATTGGTAAAGTCAAGCGAACACTTGGTCAGTTTACTCCAGCACA
rJMSF025E20+ CCGACAACCAAATATTATTGGTAAAGTCAAGCGAACACTTGGTCAGTTTACTCCAGCACA
                      ____________________________________________________________
consensus CCGACAACCAAATATTATTGGTAAAGTCAAGCGAACACTTGGTCAGTTTACTCCAGCACA
 
. : . : . : . : . : . :
rJMSF025M21+ TTGGGATAAAGATGAATGGCATCCACTTCTTGGTCCTTGGCGTTTTCTTCAAGTTCTGAG
rJMSF025E20+ TTGGGATAAAGATGAATGGCATCCACTTCTTGGTCCTTGGCGTTTTCTTCAAGTTCTGAG
                      ____________________________________________________________
consensus TTGGGATAAAGATGAATGGCATCCACTTCTTGGTCCTTGGCGTTTTCTTCAAGTTCTGAG
 
. : . : . : . : . : . :
rJMSF025M21+ CCTCTGTGTTGTGTTCTTGACGGTGGAATTGAACACGTTCTTCCTCAAGTTTTGTCTTTG
rJMSF025E20+ CCTCTGTGTTGTGTTCTTGACGGTGGAATTGAACACGTTCTTCCTCAAGTTTTGTCTTTG
                      ____________________________________________________________
consensus CCTCTGTGTTGTGTTCTTGACGGTGGAATTGAACACGTTCTTCCTCAAGTTTTGTCTTTG
 
. : . : . : . : . : . :
rJMSF025M21+ GGTTCCTCCCCGAAACCCTTTGATAATATATAGATTAGTGTTATGGTGGCTGATTGCAAT
rJMSF025E20+ GGTTCCTCCCCGAAACCCTTTGATAATATATAGATTAGTGTTATGGTGGCTGATTGCAAT
                      ____________________________________________________________
consensus GGTTCCTCCCCGAAACCCTTTGATAATATATAGATTAGTGTTATGGTGGCTGATTGCAAT
 
. : . : . : . : . : . :
rJMSF025M21+ ACCAACCATCCGGGAGTACAATTCTTACCTACAAGACAGAAAACCGGATAAAAAGGTGGG
rJMSF025E20+ ACCAACCATCCGGGAGTACAATTCTTACCTACAAGACAGAAAACCGGATAAAAAGGTGGG
                      ____________________________________________________________
consensus ACCAACCATCCGGGAGTACAATTCTTACCTACAAGACAGAAAACCGGATAAAAAGGTGGG
 
. : . : . : . : . : . :
rJMSF025M21+ AACATTTTGTTGGCTCTCCCTTGCTATCTGCATCGTTGAACTTCTAATATGCATCAAGTT
rJMSF025E20+ AACATTTTGTTGGCTCTCCCTTGCTATCTGCATCGTTGAACTTCTAATATGCATCAAGTT
                      ____________________________________________________________
consensus AACATTTTGTTGGCTCTCCCTTGCTATCTGCATCGTTGAACTTCTAATATGCATCAAGTT
 
. : . : . : . : . : . :
rJMSF025M21+ TGGGCATGGATTGTTTCATGAACCCATGCCGAAATGGTTGGTTATTCTTTGGACATCCAT
rJMSF025E20+ TGGGCATGGATTGTTTCATGAACCCATGCCGAAATGGTTGGTTATTCTTTGGACATCCAT
                      ____________________________________________________________
consensus TGGGCATGGATTGTTTCATGAACCCATGCCGAAATGGTTGGTTATTCTTTGGACATCCAT
 
. : . : . : . : . : . :
rJMSF025M21+ TGGGGTTGGGCATGTGATATTCTTGTCGGCGTGGTCATGGCAACTTATTAGGAGAAAGCA
rJMSF025E20+ TGGGGTTGGGCATGTGATATTCTTGTCGGCGTGGTCATGGCAACTTATTAGGAGAAAGCA
                      ____________________________________________________________
consensus TGGGGTTGGGCATGTGATATTCTTGTCGGCGTGGTCATGGCAACTTATTAGGAGAAAGCA
 
. : . : . : . : . : . :
rJMSF025M21+ GCAATGAACCGTAGTGTGGGTGCCTAATTCATTGATTTCTTTCTGATGTTTTCCATAACT
rJMSF025E20+ GCAATGAACCGTAGTGTGGGTGCCTAATTCATTGATTTCTTTCTGATGTTTTCCATAACT
                      ____________________________________________________________
consensus GCAATGAACCGTAGTGTGGGTGCCTAATTCATTGATTTCTTTCTGATGTTTTCCATAACT
 
. : . : . : . : . : . :
rJMSF025M21+ ATATGTTGTAAATACCCCGTATGTTGGTAATTGTATATGCTTTATTCTATTAGGTTAGAG
rJMSF025E20+ ATATGTTGTAAATACCCCGTATGTTGGTAATTGTATATGCTTTATTCTATTAGGTTAGAG
                      ____________________________________________________________
consensus ATATGTTGTAAATACCCCGTATGTTGGTAATTGTATATGCTTTATTCTATTAGGTTAGAG
 
. : . : . : . : . : . :
rJMSF025M21+ ATCACAGATGAAGCATGTAGAGAACCTCAGTTTTTACTTCAATTCATAGATAAAAGTT
rJMSF025E20+ ATCACAGATGAAGCATGTAGAGAACCTCAGTTTTTACTTCAATTCATAGATAAAAGTTGG
                      ____________________________________________________________
consensus ATCACAGATGAAGCATGTAGAGAACCTCAGTTTTTACTTCAATTCATAGATAAAAGTTGG