Previous Contig 012399:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMSF003B14Sequence272004474 (2)668012399 (3)
JMSF005F14Sequence408013552 (3)514012399 (3)pir|T47663|T476632e-08hypothetical protein T26I12.120 - Arabidopsis thaliana>gb:ATT26I12_1555481 Arabi
JMSF025D08Sequence650004474 (2)pir|T47663|T476633e-05hypothetical protein T26I12.120 - Arabidopsis thaliana>gb:ATT26I12_1555481 Arabi681012399 (3)

Alignment

This contig is upended


. : . : . : . : . : . :
rJMSF003B14+ TCTTTTTTTTTTGTCCGACTTG
rJMSF025D08+ TCTTTTTTTTTTGTCCGACTTG
                      ____________________________________________________________
consensus TCTTTTTTTTTTGTCCGACTTG
 
. : . : . : . : . : . :
rJMSF003B14+ TTCTAAGTATATCCTAATATATGAGGCATTTTTAAATCTGTATCATACTTAGACTAATCT
rJMSF025D08+ TTCTAAGTATATCCTAATATATGAGGCATTTTTAAATCTGTATCATACTTAGACTAATCT
                      ____________________________________________________________
consensus TTCTAAGTATATCCTAATATATGAGGCATTTTTAAATCTGTATCATACTTAGACTAATCT
 
. : . : . : . : . : . :
rJMSF003B14+ CCTTTCACATCGGGCCAGCCCAATTAAGGGGCAAGTGTTGGCCATATTAATTTTTTTTTT
rJMSF025D08+ CCTTTCACATCGGGCCAGCCCAATTAAGGGGCAAGTGTTGGCCATATTAATTTTTTTTTT
                      ____________________________________________________________
consensus CCTTTCACATCGGGCCAGCCCAATTAAGGGGCAAGTGTTGGCCATATTAATTTTTTTTTT
 
. : . : . : . : . : . :
rJMSF003B14+ ATACAAAATGAGTTTTTGATGAACGTATTCCTAACCTCTTTTAAGGGATAAGAATGCACG
rJMSF025D08+ ATACAAAATGAGTTTTTGATGAACGTATTCCTAACCTCTTTTAAGGGATAAGAATGCACG
                      ____________________________________________________________
consensus ATACAAAATGAGTTTTTGATGAACGTATTCCTAACCTCTTTTAAGGGATAAGAATGCACG
 
. : . : . : . : . : . :
rJMSF003B14+ ACTACTCATGCTAACCAATATGAATATACAGGTTGAGGTTTTACATTGTCATAATTTAGA
rJMSF025D08+ ACTACTCATGCTAACCAATATGAATATACAGGTTGAGGTTTTACATTGTCATAATTTAGA
                      ____________________________________________________________
consensus ACTACTCATGCTAACCAATATGAATATACAGGTTGAGGTTTTACATTGTCATAATTTAGA
 
. : . : . : . : . : . :
rJMSF005F14+ AGGTAGGCATGGGAGGA
rJMSF003B14+ TGTATATATGTGATTATTGTTTGTATGTACCTTAATGTTGTACAGGTAGGCATGGGAGGA
rJMSF025D08+ TGTATATATGTGATTATTGTTTGTATGTACCTTAATGTTGTACAGGTAGGCATGGGAGGA
                      ____________________________________________________________
consensus TGTATATATGTGATTATTGTTTGTATGTACCTTAATGTTGTACAGGTAGGCATGGGAGGA
 
. : . : . : . : . : . :
rJMSF005F14+ TATACCCAAGAAATGGGAGGAGGAGCCAATGGAAATGAAGAAAACATACACATGTCTGGT
rJMSF003B14+ TATACCCAAGAAATGGGAGGAGGAGCCAATGGAAATGAAGAAAACATACACATGTCTGGT
rJMSF025D08+ TATACCCAAGAAATGGGAGGAGGAGCCAATGGAAATGAAGAAAACATACACATGTCTGGT
                      ____________________________________________________________
consensus TATACCCAAGAAATGGGAGGAGGAGCCAATGGAAATGAAGAAAACATACACATGTCTGGT
 
. : . : . : . : . : . :
rJMSF005F14+ CAGGGATAGATGTCATGAATTAATGTGGTTGTCCTCGAAGCTAAGGCATAATAATGAAAC
rJMSF003B14+ CAGGGATAGATGTCATGAATTAATGTGGTTGTCCTCGAAGCTAAGGCATAATAATGAAAC
rJMSF025D08+ CAGGGATAGATGTCATGAATTAATGTGGTTGTCCTCGAAGCTAAGGCATAATAATGAAAC
                      ____________________________________________________________
consensus CAGGGATAGATGTCATGAATTAATGTGGTTGTCCTCGAAGCTAAGGCATAATAATGAAAC
 
. : . : . : . : . : . :
rJMSF005F14+ AGTGGCCGATGTTTTAGGGTTATTTATATTTGGAAATTATATATATTTACCTCATAATTA
rJMSF003B14+ AGTGGCCGATGTTTTAGGGTTATTTATATTTGGAAATTATATATATTTACCTCGTAATTA
rJMSF025D08+ AGTGGCCGATGTTTTAGGGTTATTTATATTTGGAAATTATATATATTTACCTCGTAATTA
                      ____________________________________________________________
consensus AGTGGCCGATGTTTTAGGGTTATTTATATTTGGAAATTATATATATTTACCTCGTAATTA
 
. : . : . : . : . : . :
rJMSF005F14+ TCCTAGTATAGAATGACGTGTAGCTTGTAGGGACCATATAAATGAAGAATGTTTTCTTAT
rJMSF003B14+ TCCTAGTATAGAATGACGTGTAGCTTGTAGGGACCATATAAATGAAGAATGTTTTCTTAT
rJMSF025D08+ TCCTAGTATAGAATGACGTGTAGCTTGTAGGGACCATATAAATGAAGAATGTTTTCTTAT
                      ____________________________________________________________
consensus TCCTAGTATAGAATGACGTGTAGCTTGTAGGGACCATATAAATGAAGAATGTTTTCTTAT
 
. : . : . : . : . : . :
rJMSF005F14+ CCTTTCTTAATCACATCTATCGATCATAACATGGTAATGGCTGTAATATAATAGTCTCTT
rJMSF003B14+ CCTTTCTTAATCACATCTATCGATCATAACATGGTAATGGCTGTAATATAATAGTCTCTT
rJMSF025D08+ CCTTTCTTAATCACATCTATCGATCATAACATGGTAATGGCTGTAATATAATAGTCTCTT
                      ____________________________________________________________
consensus CCTTTCTTAATCACATCTATCGATCATAACATGGTAATGGCTGTAATATAATAGTCTCTT
 
. : . : . : . : . : . :
rJMSF005F14+ GTAGATATCTCTAGATATAATANCTNTGTAAGTNTGGGNTGTGAAAC
rJMSF003B14+ GTAGATATCTCTAGATATAATA-CTTTGTAAGTTTGGGTTGTGAAAC
rJMSF025D08+ GTAGATATCTCTAGATATAATA-CTTTGTAAGTTTGGGTTGTGAAACCTTGTGATTCAAT
                      ____________________________________________________________
consensus GTAGATATCTCTAGATATAATA-CTTTGTAAGTTTGGGTTGTGAAACCTTGTGATTCAAT