Previous Contig 012396:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMSF025D03Sequence591012396 (2)gb:AY099869_15768941e-37Arabidopsis thaliana FKBP-type peptidyl-prolyl cis-trans isomerase, putative (At616012396 (2)gb:AY099869_15768941e-35Arabidopsis thaliana FKBP-type peptidyl-prolyl cis-trans isomerase, putative (At

Alignment

This contig is upended


. : . : . : . : . : . :
JMSF025D03- GACTCTATCACTTCCAAAGTCGA
rJMSF025D03+ TCACTTCCAAAGTCGA
                      ____________________________________________________________
consensus GACTCTATCACTTCCAAAGTCGA
 
. : . : . : . : . : . :
JMSF025D03- ATTCATTATTCTCGCCATCCTCTTTCAAGCCGCACGCACATCCATATCTCCCCTTCGTCG
rJMSF025D03+ ATTCATTATTCTCGCCATCCTCTTTCAAGCCGCACGCACATCCATATCTCCCCTTCGTCG
                      ____________________________________________________________
consensus ATTCATTATTCTCGCCATCCTCTTTCAAGCCGCACGCACATCCATATCTCCCCTTCGTCG
 
. : . : . : . : . : . :
JMSF025D03- TTCGGGCCACCGCCACCGGCGACGATTCCGCCTCCGAAACTGAAGAAGAAGAAGCGGACG
rJMSF025D03+ TTCGGGCCACCGCCACCGGCGACGATTCCGCCTCCGAAACTGAAGAAGAAGAAGCGGACG
                      ____________________________________________________________
consensus TTCGGGCCACCGCCACCGGCGACGATTCCGCCTCCGAAACTGAAGAAGAAGAAGCGGACG
 
. : . : . : . : . : . :
JMSF025D03- ACTTCGAGTCGCGCCTCTCCAACGTCCGTATTAAGTACCGGAGCGGGCTGGGGAAGAAAG
rJMSF025D03+ ACTTCGAGTCGCGCCTNTCCAACGTCCGTATTAAGTACCGGAGCGGGCTGGGGAAGAAAG
                      ____________________________________________________________
consensus ACTTCGAGTCGCGCCTCTCCAACGTCCGTATTAAGTACCGGAGCGGGCTGGGGAAGAAAG
 
. : . : . : . : . : . :
JMSF025D03- CAGAGCGCAGAAAGTCTCGGCAAGGGAAGAAGGTGGCGTCGGAGTCGGGATCCGGAATGT
rJMSF025D03+ CAGAGCGCAGAAAGTCTCGGCAAGGGAAGAAGGTGGCGTNGGAGTCGGGATCCGGAATGT
                      ____________________________________________________________
consensus CAGAGCGCAGAAAGTCTCGGCAAGGGAAGAAGGTGGCGTCGGAGTCGGGATCCGGAATGT
 
. : . : . : . : . : . :
JMSF025D03- ACCTCCCGCCGGTGTCGCTGCGGGAGGCGGTTTCCGAAGGGCTGAGCGTGGAATTCGGGT
rJMSF025D03+ ACCTCCCGCCGGTGTCGCTGCGGGAGGCGGTTTCCGAAGGGCTGAGCGTGGAATTCGGGT
                      ____________________________________________________________
consensus ACCTCCCGCCGGTGTCGCTGCGGGAGGCGGTTTCCGAAGGGCTGAGCGTGGAATTCGGGT
 
. : . : . : . : . : . :
JMSF025D03- TCACCCCGTTTTCGGAACGGGTCAACGGCCGGATTGCGATTCTGGGCATAACCGCTTTGG
rJMSF025D03+ TCNCCCCGTTTTCGGAACGGGTCAACGGCCGGATTGCGATTNTGGGCATAACCGCTTTGG
                      ____________________________________________________________
consensus TCACCCCGTTTTCGGAACGGGTCAACGGCCGGATTGCGATTCTGGGCATAACCGCTTTGG
 
. : . : . : . : . : . :
JMSF025D03- TATTGGTGGAGCTGGCGACGGGGCAGGGCGTTATAAAGTATCATACGCCGTCGATAGTTC
rJMSF025D03+ TATTGGTGGAGCTGGCGACGGGGCAGGGCGTTATAAAGTATCNTACGCCGTCGATAGTTN
                      ____________________________________________________________
consensus TATTGGTGGAGCTGGCGACGGGGCAGGGCGTTATAAAGTATCATACGCCGTCGATAGTTC
 
. : . : . : . : . : . :
JMSF025D03- TAATTCAGGTTTACTTCGTGGCGGCGGTGGCGGCGTTGTACGTTAAGTACGAGAAGGAAA
rJMSF025D03+ TAATTCAGGTTTACTTCGTGGCGGCGGTGGCGGCGTTGTACGTTAAGTACGAGAAGGAAA
                      ____________________________________________________________
consensus TAATTCAGGTTTACTTCGTGGCGGCGGTGGCGGCGTTGTACGTTAAGTACGAGAAGGAAA
 
. : . : . : . : . : . :
JMSF025D03- AAGTTAGTGTGTGGCCATCAGACAAATGAAAATCATCGTTGCCTTTAATTTATTTTTTTT
rJMSF025D03+ AAGTTAGTGTGTGGCCNTCNGACAAATGAAAATCATCGTTGCCTTTAATTTATTTTTTTT
                      ____________________________________________________________
consensus AAGTTAGTGTGTGGCCATCAGACAAATGAAAATCATCGTTGCCTTTAATTTATTTTTTTT
 
. : . : . : . : . : . :
JMSF025D03- TTTCCAGCAAAAAATTGTGAAATTGCCT
rJMSF025D03+ TTTCCAGCAAAAAATTGTGAAATTGCCTTATACTGTTATATATATTCCAATGTTTTAGTT
                      ____________________________________________________________
consensus TTTCCAGCAAAAAATTGTGAAATTGCCTTATACTGTTATATATATTCCAATGTTTTAGTT