Previous Contig 012395:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF036P06Sequence387006740 (3)gb:AY093583_15753521e-49Oryza sativa (japonica cultivar-group) RNase L inhibitor-like protein mRNA, comp723012395 (3)gb:AY099697_15767223e-86Arabidopsis thaliana RNase L inhibitor-like protein (At4g19210) mRNA, complete c
JMSF025D01Sequence652006740 (3)gb:AY093583_1575352e-110Oryza sativa (japonica cultivar-group) RNase L inhibitor-like protein mRNA, comp721012395 (3)gb:AY099697_15767222e-74Arabidopsis thaliana RNase L inhibitor-like protein (At4g19210) mRNA, complete c
JMSF031H13Sequence653006740 (3)gb:AY093583_15753529e-99Oryza sativa (japonica cultivar-group) RNase L inhibitor-like protein mRNA, comp746012395 (3)gb:AY099697_15767224e-84Arabidopsis thaliana RNase L inhibitor-like protein (At4g19210) mRNA, complete c

Alignment

This contig is upended


. : . : . : . : . : . :
rJMFF036P06+ TACTGTGAGACATTTGCTACATCAGAAAATACGTGATTCTTATACCCATCCTCAGTTTAA
rJMSF031H13+ TACTGTGAGACA-TTGCTACATCAGAAAATACGTGATTCTTATACCCATCCTCAGTTTAA
rJMSF025D01+ A
                      ____________________________________________________________
consensus TACTGTGAGACATTTGCTACATCAGAAAATACGTGATTCTTATACCCATCCTCAGTTTAA
 
. : . : . : . : . : . :
rJMFF036P06+ CTCAGATGTTATGAAGCCTCTGCAAATCGAGCAATTGATGGATCAAGAAGTCGTGAACTT
rJMSF031H13+ CTCAGATGTTATGAAGCCTCTGCAAATCGAGCAATTGATGGATCAAGAAGTCGTGAACTT
rJMSF025D01+ CTCAGATGTTATGAAGCNTCTGCAAATCGAGCAATTGATGGATCAAGAAGTCGTGAACTT
                      ____________________________________________________________
consensus CTCAGATGTTATGAAGCCTCTGCAAATCGAGCAATTGATGGATCAAGAAGTCGTGAACTT
 
. : . : . : . : . : . :
rJMFF036P06+ ATCTGGTGGAGAGTTGCAAAGAGTTGCCTTGGTTTTGTGTCTTGGGAAGCCTGCCGATAT
rJMSF031H13+ ATCTGGTGGAGAGTTGCAAAGAGTTGCCTTGGTTTTGTGTCTTGGGAAGCCTGCCGATAT
rJMSF025D01+ ATCTGGTGGAGAGTTGCAAAGAGTTGCCTTGGTTTTGTGTCTTGGGAAGCCTGCCGATAT
                      ____________________________________________________________
consensus ATCTGGTGGAGAGTTGCAAAGAGTTGCCTTGGTTTTGTGTCTTGGGAAGCCTGCCGATAT
 
. : . : . : . : . : . :
rJMFF036P06+ CTATTTAATTGATGAACCGAGCGCATATCTAGATTCTGAGCAGCGTATCGTCGCTTCGAA
rJMSF031H13+ CTATTTAATTGATGAACCGAGCGCATATCTAGATTCTGAGCAGCGTATCGTCGCTTCGAA
rJMSF025D01+ CTATTTAATTGATGAACCGAGCGCATATCTAGATTCTGAGCAGCGTATCGTCGCTTCGAA
                      ____________________________________________________________
consensus CTATTTAATTGATGAACCGAGCGCATATCTAGATTCTGAGCAGCGTATCGTCGCTTCGAA
 
. : . : . : . : . : . :
rJMFF036P06+ AGTTATAAAGAGGTTTATTCTTCATGCAAAGAAGACCGCGTTTGTGGTGGAACATGACTT
rJMSF031H13+ AGTTATAAAGAGGTTTATTCTTCATGCAAAGAAGACCGCGTTTGTGGTGGAACATGACTT
rJMSF025D01+ AGTTATAAAGAGGTTTATTCTTCATGCAAAGAAGACCGCGTTTGTGGTGGAACATGACTT
                      ____________________________________________________________
consensus AGTTATAAAGAGGTTTATTCTTCATGCAAAGAAGACCGCGTTTGTGGTGGAACATGACTT
 
. : . : . : . : . : . :
rJMFF036P06+ CATAATGGCAACCTACTTGGCCGATAGAGTCATCGTGTATGAAGGGATGCCATCGGTGGA
rJMSF031H13+ CATAATGGCAACCTACTTGGCCGATAGAGTCATCGTGTATGAAGGGATGCCATCGGTGGA
rJMSF025D01+ CATAATGGCAACCTACTTGGCCGATAGAGTCATCGTGTATGAAGGGATGCCATCGGTGGA
                      ____________________________________________________________
consensus CATAATGGCAACCTACTTGGCCGATAGAGTCATCGTGTATGAAGGGATGCCATCGGTGGA
 
. : . : . : . : . : . :
rJMFF036P06+ TTGTATAGCAAATTCACCACAGTCATTGTTGACCGGAATGAACCTATTCTTATCTCACCT
rJMSF031H13+ TTGTATAGCAAATTCACCACAGTCATTGTTGACCGGAATGAACCTATTCTTATCTCACCT
rJMSF025D01+ TTGTATAGCAAATTCACCACAGTCATTGTTGACCGGAATGAACCTATTCTTATCTCACCT
                      ____________________________________________________________
consensus TTGTATAGCAAATTCACCACAGTCATTGTTGACCGGAATGAACCTATTCTTATCTCACCT
 
. : . : . : . : . : . :
rJMFF036P06+ GGATATTACGTTTAGACGGGATCCAACTAATTATCGCCCAAGAATCAACAAACTGGAGTC
rJMSF031H13+ GGATATTACGTTTAGACGGGATCCAACTAATTATCGCCCAAGAATCAACAAACTGGAGTC
rJMSF025D01+ GGATATTACGTTTAGACGGGATCCAACTAATTATCGCCCAAGAATCAACAAACTGGAGTC
                      ____________________________________________________________
consensus GGATATTACGTTTAGACGGGATCCAACTAATTATCGCCCAAGAATCAACAAACTGGAGTC
 
. : . : . : . : . : . :
rJMFF036P06+ AACCAAGGACAGGGAGCAAAAGGCAGCAGGATCATACTATTACCTGGATGATT
rJMSF031H13+ AACCAAGGACAGGGAGCAAAAGGCAGCAGGATCATACTATTACCTGGATGATT
rJMSF025D01+ AACCAAGGACAGGGAGCAAAAGGCAGCAGGATCATACTATTACCTGGATGATTAAATGTA
                      ____________________________________________________________
consensus AACCAAGGACAGGGAGCAAAAGGCAGCAGGATCATACTATTACCTGGATGATTAAATGTA
 
. : . : . : . : . : . :
rJMSF025D01+ ACTTTTAACACATGCCTCTTTTTACTGGCACCTTTGTTGAAGATGAAATGGTCTTTTGTG
                      ____________________________________________________________
consensus ACTTTTAACACATGCCTCTTTTTACTGGCACCTTTGTTGAAGATGAAATGGTCTTTTGTG
 
. : . : . : . : . : . :
rJMSF025D01+ TCCTCTGATTGTTATAGGTTTAAAGTTTTATTTAGTTTAGTACAATCACCGGGGGCCCTT
                      ____________________________________________________________
consensus TCCTCTGATTGTTATAGGTTTAAAGTTTTATTTAGTTTAGTACAATCACCGGGGGCCCTT
 
. : . : . : . : . : . :
rJMSF025D01+ ATGCGAAGAGAAGAGTAACGATTCAAAATCGCCTTTTCTGGGCCATTTTGTGCAAGTAAT
                      ____________________________________________________________
consensus ATGCGAAGAGAAGAGTAACGATTCAAAATCGCCTTTTCTGGGCCATTTTGTGCAAGTAAT
 
. : . : . : . : . : . :
rJMSF025D01+ TTTGGGTAAGTTCTGCTTGTATTATTTTTACCTGACACAAAGAATGCCTTACACATACAC
                      ____________________________________________________________
consensus TTTGGGTAAGTTCTGCTTGTATTATTTTTACCTGACACAAAGAATGCCTTACACATACAC