Previous Contig 012390:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMSF006F21Sequence341012390 (6)gb:AE016959_10239396e-20Oryza sativa (japonica cultivar-group) chromosome 10, complete sequence.>gb:AC06432012390 (6)gb:AE016959_10239391e-48Oryza sativa (japonica cultivar-group) chromosome 10, complete sequence.>gb:AC06
JMSF023B17Sequence684012390 (6)gb:AE016959_10239396e-74Oryza sativa (japonica cultivar-group) chromosome 10, complete sequence.>gb:AC06759012390 (6)gb:AE016959_10239398e-84Oryza sativa (japonica cultivar-group) chromosome 10, complete sequence.>gb:AC06
JMSF025B17Sequence666012390 (6)gb:AE016959_10239391e-60Oryza sativa (japonica cultivar-group) chromosome 10, complete sequence.>gb:AC06770012390 (6)gb:AE016959_10239393e-85Oryza sativa (japonica cultivar-group) chromosome 10, complete sequence.>gb:AC06

Alignment

This contig is upended


. : . : . : . : . : . :
JMSF025B17- GACGAATATGA
                      ____________________________________________________________
consensus GACGAATATGA
 
. : . : . : . : . : . :
JMSF006F21- GTCACATATATTCTTAAAGTTTTAGTTGGGTTG
JMSF025B17- GATACTACATTGCTGTTCCTTGTCGCAGTCACATATATTCTTAAAGTTTTAGTTGGGTTG
                      ____________________________________________________________
consensus GATACTACATTGCTGTTCCTTGTCGCAGTCACATATATTCTTAAAGTTTTAGTTGGGTTG
 
. : . : . : . : . : . :
JMSF006F21- GGGCCTTGAAGAGGTGAGTTTGCCGCAACAATTTCGTCTGCCTCCTCGAATCGTCTCCCT
JMSF025B17- GGGCCTTGAAGAGGTGAGTTTGCCGCAACAATTTCGTCTGCCTCCTCGAATCGTCTCCCT
JMSF023B17- GAGTTTGCCGCAACAATTTCGTCTGCCTCCTCGAATCGTCTCCCT
                      ____________________________________________________________
consensus GGGCCTTGAAGAGGTGAGTTTGCCGCAACAATTTCGTCTGCCTCCTCGAATCGTCTCCCT
 
. : . : . : . : . : . :
JMSF006F21- CTCTTGCAGGTGCGGTTGGCTCATTGCCCTAAAGGTCTTAGATTAAGGACTGGGGTTCAT
JMSF025B17- CTCTTGCAGGTGCGGTTGGCTCATTGCCCTAAAGGTCTTAGATTAAGGACTGGGGTTCAT
JMSF023B17- CTCTTGCAGGTGCGGTTGGCTCATTGCCCTAAAGGTCTTAGATTAAGGACTGGGGTTCAT
                      ____________________________________________________________
consensus CTCTTGCAGGTGCGGTTGGCTCATTGCCCTAAAGGTCTTAGATTAAGGACTGGGGTTCAT
 
. : . : . : . : . : . :
JMSF006F21- CTGAGATCAAGGAAATCAATTGCAATGGGTGATGTTGCCAAGGATTTGACTGCCGGGACT
JMSF025B17- CTGAGATCAAGGAAATCAATTGCAATGGGTGATGTTGCCAAGGATTTGACTGCCGGGACT
JMSF023B17- CTGAGATCAAGGAAATCAATTGCAATGGGTGATGTTGCCAAGGATTTGACTGCCGGGACT
                      ____________________________________________________________
consensus CTGAGATCAAGGAAATCAATTGCAATGGGTGATGTTGCCAAGGATTTGACTGCCGGGACT
 
. : . : . : . : . : . :
JMSF006F21- GTTGGAGGGGCGGCGCAATTGATATGTGGTCATCCTTTTGATACCATTAAGGTGAAGCTA
JMSF025B17- GTTGGAGGGGCGGCGCAATTGATATGTGGTCATCCTTTTGATACCATTAAGGTGAAGCTA
JMSF023B17- GTTGGAGGGGCGGCGCAATTGATATGTGGTCATCCTTTTGATACCATTAAGGTGAAGCTA
                      ____________________________________________________________
consensus GTTGGAGGGGCGGCGCAATTGATATGTGGTCATCCTTTTGATACCATTAAGGTGAAGCTA
 
. : . : . : . : . : . :
JMSF006F21- CAAAGTCAGCCGGCTCCCCTTCCCGGGCAGGCGCCGAAATATTCGGGTGCCATGGATGCT
JMSF025B17- CAAAGTCAGCCGGCTCCCCTTCCCGGGCAGGCGCCGAAATATTCGGGTGCCATGGATGCT
JMSF023B17- CAAAGTCAGCCGGCTCCCCTTCCCGGGCAGGCGCCGAAATATTCGGGTGCCATGGATGCT
                      ____________________________________________________________
consensus CAAAGTCAGCCGGCTCCCCTTCCCGGGCAGGCGCCGAAATATTCGGGTGCCATGGATGCT
 
. : . : . : . : . : . :
JMSF006F21- GTAA
JMSF025B17- GTAAGGCAGACAGTCGCTGCAGAAGGCCCGAGGGGTTTGTACAAAGGCATGGGAGCCCCG
JMSF023B17- GTAAGGCAGACAGTCGCTGCAGAAGGCCCGAGGGGTTTGTACAAAGGCATGGGAGCCCCG
                      ____________________________________________________________
consensus GTAAGGCAGACAGTCGCTGCAGAAGGCCCGAGGGGTTTGTACAAAGGCATGGGAGCCCCG
 
. : . : . : . : . : . :
JMSF025B17- CTTGCGACTGTGGCTGCCTTCAACGCTGTGCTCTTCACGGTTAGAGGTCAAATGGAGACA
JMSF023B17- CTTGCGACTGTGGCTGCCTTCAACGCTGTGCTCTTCACGGTTAGAGGTCAAATGGAGACA
rJMSF023B17+ TTCAACGCTGTGCTNTTCACGGTTAGAGGTCAAATGGAGACA
rJMSF025B17+ GTGGCTGCCTTCAACGCTGTGCTCTTCACGGTTAGAGGTCAAATGGAGACA
                      ____________________________________________________________
consensus CTTGCGACTGTGGCTGCCTTCAACGCTGTGCTCTTCACGGTTAGAGGTCAAATGGAGACA
 
. : . : . : . : . : . :
JMSF025B17- TTGGTGAGGTCTGAACCAGGTGTCCCGCTTACTGTGAGCCAGCAAATCATTTGCGGGGCA
JMSF023B17- TTGGTGAGGTCTGAACCAGGTGTCCCGCTTACTGTGAGCCAGCAAATCATTTGCGGGGCA
rJMSF023B17+ TTGGTGAGGTCTGAACCAGGTGTCCCGCTTACTGTGAGCCAGCAAATCATTTGCGGGGCA
rJMSF025B17+ TTGGTGAGGTCTGAACCAGGTGTCCCGCTTACTGTGAGCCAGCAAATCATTTGCGGGGCA
                      ____________________________________________________________
consensus TTGGTGAGGTCTGAACCAGGTGTCCCGCTTACTGTGAGCCAGCAAATCATTTGCGGGGCA
 
. : . : . : . : . : . :
JMSF025B17- GGGGCAGGAACTGCCGTTTCTTTTCTCGCCTGCCCAACTGAATTAATCAAATGCAGATTG
JMSF023B17- GGGGCAGGAACTGCCGTTTCTTTTCTCGCCTGCCCAACTGAATTAATCAAATGCAGATTG
rJMSF023B17+ GGGGCAGGAACTGCCGTTTCTTTTCTCGCCTGCCCAACTGAATTAATCAAATGCAGATTG
rJMSF025B17+ GGGGCAGGAACTGCCGTTTCTTTTCTCGCCTGCCCAACTGAATTAATCAAATGCAGATTG
                      ____________________________________________________________
consensus GGGGCAGGAACTGCCGTTTCTTTTCTCGCCTGCCCAACTGAATTAATCAAATGCAGATTG
 
. : . : . : . : . : . :
JMSF025B17- CAGGCGCAGAGTGCGTTAGCTGTANCAGGTGGAGCTGCGGTGGCAGCAGTGAA
JMSF023B17- CAGGCGCAGAGTGCGTTAGCTGTAGCAGGTGGAGCTGCGGTGGCAGCAGTGAAGTATTCC
rJMSF023B17+ CAGGCGCAGAGTGCGTTAGCTGTAGCAGGTGGAGCTGCGGTGGCAGCAGTGAAGTATTCC
rJMSF025B17+ CAGGCGCAGAGTGCGTTAGCTGTAGCAGGTGGAGCTGCGGTGGCAGCAGTGAAGTATTCC
                      ____________________________________________________________
consensus CAGGCGCAGAGTGCGTTAGCTGTAGCAGGTGGAGCTGCGGTGGCAGCAGTGAAGTATTCC
 
. : . : . : . : . : . :
JMSF023B17- GGGCCAATGGACGTGGCGAGGCAAGTCCTCCGGTCCGAAGGANGCACGAGGGGCCTCTTC
rJMSF006F21+ TCCGAAGGAGGCACGANGGGCCTNTNC
rJMSF023B17+ GGGCCAATGGACGTGGCGAGGCAAGTCCTCCGGTCCGAAGGAGGCACGAGGGGCCTCTTC
rJMSF025B17+ GGGCCAATGGACGTGGCGAGGCAAGTCCTCCGGTCCGAAGGAGGCACGAGGGGCCTCTTC
                      ____________________________________________________________
consensus GGGCCAATGGACGTGGCGAGGCAAGTCCTCCGGTCCGAAGGAGGCACGAGGGGCCTCTTC
 
. : . : . : . : . : . :
JMSF023B17- AAGGGACTGGTCCCCACTATGGCTCGTGAAATACCCGGA
rJMSF006F21+ AAGGGACTGGTCCCCANTATGGCTCGTGAAATACCCGGAAACGCTGCAATGTTCGGTGTG
rJMSF023B17+ AAGGGACTGGTCCCCACTATGGCTCGTGAAATACCCGGAAACGCTGCAATGTTCGGTGTG
rJMSF025B17+ AAGGGACTGGTCCCCACTATGGCTCGTGAAATACCCGGAAACGCTGCAATGTTCGGTGTG
                      ____________________________________________________________
consensus AAGGGACTGGTCCCCACTATGGCTCGTGAAATACCCGGAAACGCTGCAATGTTCGGTGTG
 
. : . : . : . : . : . :
rJMSF006F21+ TACGAGGCCATAAAGCAGTACCTTGCAGGCGGGCAGGACACTTCGGGGCTGGGACGAGGC
rJMSF023B17+ TACGAGGCCATAAAGCAGTACCTTGCAGGCGGGCAGGACACTTCGGGGCTGGGACGAGGC
rJMSF025B17+ TACGAGGCCATAAAGCAGTACCTTGCAGGCGGGCAGGACACTTCGGGGCTGGGACGAGGC
                      ____________________________________________________________
consensus TACGAGGCCATAAAGCAGTACCTTGCAGGCGGGCAGGACACTTCGGGGCTGGGACGAGGC
 
. : . : . : . : . : . :
rJMSF006F21+ TCTCTGATTATAGCAGGAGGACTGGCTGGGGCTTCCTTTTGGATTTCTGTCTACCCCACC
rJMSF023B17+ TCTCTGATTATAGCAGGAGGACTGGCTGGGGCTTCCTTTTGGATTTCTGTCTACCCCACC
rJMSF025B17+ TCTCTGATTATAGCAGGAGGACTGGCTGGGGCTTCCTTTTGGATTTCTGTCTACCCCACC
                      ____________________________________________________________
consensus TCTCTGATTATAGCAGGAGGACTGGCTGGGGCTTCCTTTTGGATTTCTGTCTACCCCACC
 
. : . : . : . : . : . :
rJMSF006F21+ GACGTGATCAAGAGCGTAATCCAGGTNGACGATTACAAGAAGCCTAAGTTCTCGGGCTCC
rJMSF023B17+ GACGTGATCAAGAGCGTAATCCAGGTCGACGATTACAAGAAGCCTAAGTTCTCGGGCTCC
rJMSF025B17+ GACGTGATCAAGAGCGTAATCCAGGTCGACGATTACAAGAAGCCTAAGTTCTCGGGCTCC
                      ____________________________________________________________
consensus GACGTGATCAAGAGCGTAATCCAGGTCGACGATTACAAGAAGCCTAAGTTCTCGGGCTCC
 
. : . : . : . : . : . :
rJMSF006F21+ ATCGACGCCTTCAAAAAGATCTTGGCGTCGGAGGGAGTGAAGGGCCTTTACAAAGGATTT
rJMSF023B17+ ATCGACGCCTTCAAAAAGATCTTGGCGTCGGAGGGAGTGAAGGGCCTTTACAAAGGATTT
rJMSF025B17+ ATCGACGCCTTCAAAAAGATCTTGGCGTCGGAGGGAGTGAAGGGCCTTTACAAAGGATTT
                      ____________________________________________________________
consensus ATCGACGCCTTCAAAAAGATCTTGGCGTCGGAGGGAGTGAAGGGCCTTTACAAAGGATTT
 
. : . : . : . : . : . :
rJMSF006F21+ GGACCAGCCATGGCTAGAAGTGTTCCAGCAAATGCAGCTTGNTTCTTGGCTTATGAGGTT
rJMSF023B17+ GGACCAGCCATGGCTAGAAGTGTTCCAGCAAATGCAGCTTGCTTCTTGGCTTATGAGGTT
rJMSF025B17+ GGACCAGCCATGGCTAGAAGTGTTCCAGCAAATGCAGCTTGCTTCTTGGCTTATGAGGTT
                      ____________________________________________________________
consensus GGACCAGCCATGGCTAGAAGTGTTCCAGCAAATGCAGCTTGCTTCTTGGCTTATGAGGTT
 
. : . : . : . : . : . :
rJMSF006F21+ ATCAAGGTCCANTTTGGGCTAATAATATAATGCCTTTCTTAACCA
rJMSF023B17+ A-CAAGGTCCAGTTTGGGCTAATAATATAATGCCTTTCTTAACCATTCATTCTCAGCTTT
rJMSF025B17+ A-CAAGGTCCAGTTTGGGCTAATAATATAATGCCTTTCTTAACCATTCATTCTCAGCTTT
                      ____________________________________________________________
consensus A-CAAGGTCCAGTTTGGGCTAATAATATAATGCCTTTCTTAACCATTCATTCTCAGCTTT
 
. : . : . : . : . : . :
rJMSF023B17+ TCAGCTAGCCATTTCTCATTCAACAATTTATTCTTATTTCATAACAATTTTAT
rJMSF025B17+ TCAGCTAGCCATTTCTCATTCAACAATTTATTCTTATTTCATAACAATTTTATTCAAAAT
                      ____________________________________________________________
consensus TCAGCTAGCCATTTCTCATTCAACAATTTATTCTTATTTCATAACAATTTTATTCAAAAT