Previous Contig 012388:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMSF005J09Sequence425018431gb:AB017067_15134242e-20Arabidopsis thaliana genomic DNA, chromosome 5, P1 clone:MJC20.>gb:AY088241_1573203012388 (3)
JMSF025B09Sequence706004734 (4)gb:AY091770_15747304e-43Arabidopsis thaliana MFL8.1/MFL8.1 mRNA, complete cds.>gb:BT002277_1635880 Arabi725012388 (3)gb:AY091770_15747301e-29Arabidopsis thaliana MFL8.1/MFL8.1 mRNA, complete cds.>gb:BT002277_1635880 Arabi
JMSF027H11Sequence602004734 (4)gb:AY091770_15747304e-20Arabidopsis thaliana MFL8.1/MFL8.1 mRNA, complete cds.>gb:BT002277_1635880 Arabi779012388 (3)gb:AY091770_15747301e-31Arabidopsis thaliana MFL8.1/MFL8.1 mRNA, complete cds.>gb:BT002277_1635880 Arabi

Alignment

This contig is upended


. : . : . : . : . : . :
rJMSF027H11+ TTCCAGAACATCAACAGATGTTCATTAAACA
                      ____________________________________________________________
consensus TTCCAGAACATCAACAGATGTTCATTAAACA
 
. : . : . : . : . : . :
rJMSF027H11+ TCAAACTGCCTGATGGTTCCAGTTTACAGGTGAAGCTGTCAGTGATGGACACTTTGAGAG
                      ____________________________________________________________
consensus TCAAACTGCCTGATGGTTCCAGTTTACAGGTGAAGCTGTCAGTGATGGACACTTTGAGAG
 
. : . : . : . : . : . :
rJMSF027H11+ CAGTCAAAGACCATATTGATAGAAACCAATCCATCGGCTTTTCTTCTTATGATCTTGCAG
rJMSF025B09+ TGCAG
                      ____________________________________________________________
consensus CAGTCAAAGACCATATTGATAGAAACCAATCCATCGGCTTTTCTTCTTATGATCTTGCAG
 
. : . : . : . : . : . :
rJMSF027H11+ TTCCTTATCCACGCAAGGTCTTTACTGATCAAGATTTGGATAAAACATTATCAGAGTTGA
rJMSF025B09+ TTCCTTATCCACGCAAGGTCTTTACTGATCAAGATTTGGATAAAACATTATCAGAGTTGA
                      ____________________________________________________________
consensus TTCCTTATCCACGCAAGGTCTTTACTGATCAAGATTTGGATAAAACATTATCAGAGTTGA
 
. : . : . : . : . : . :
rJMSF027H11+ ATCTCTTCAATCGACAAGCACTGATTGTGGTTCTTCATCACAAAGGAAGTTCTTCATTGC
rJMSF025B09+ ATCTCTTCAATCGACAAGCACTGATTGTGGTTCTTCATCACAAAGGAAGTTCTTCATTGC
                      ____________________________________________________________
consensus ATCTCTTCAATCGACAAGCACTGATTGTGGTTCTTCATCACAAAGGAAGTTCTTCATTGC
 
. : . : . : . : . : . :
rJMSF027H11+ GTGACCAGAATATTTTGGCCAACAATACTAGTGCCACAAGTGGTAATGCCGAAGGATATT
rJMSF025B09+ GTGACCAGAATATTTTGGCCAACAATACTAGTGCCACAAGTGGTAATGCCGAAGGATATT
                      ____________________________________________________________
consensus GTGACCAGAATATTTTGGCCAACAATACTAGTGCCACAAGTGGTAATGCCGAAGGATATT
 
. : . : . : . : . : . :
rJMSF027H11+ TTTCTCTTGTTAGACGACTCGTCTCTTATGTGAATCCTTTTTCCTATCTTGGTGGGGGTG
rJMSF025B09+ TTTCTCTTGTTAGACGACTCGTCTCTTATGTGAATCCTTTTTCCTATCTTGGTGGGGGTG
                      ____________________________________________________________
consensus TTTCTCTTGTTAGACGACTCGTCTCTTATGTGAATCCTTTTTCCTATCTTGGTGGGGGTG
 
. : . : . : . : . : . :
rJMSF027H11+ CAAGCTCATCAGATGCTGTACAGGATTCTCAAAGCGCCACATTGCAATATGGTTCAAATC
rJMSF025B09+ CAAGCTCATCAGATGCTGTACAGGATTCTCAAAGCGCCACATTGCAATATGGTTCAAATC
                      ____________________________________________________________
consensus CAAGCTCATCAGATGCTGTACAGGATTCTCAAAGCGCCACATTGCAATATGGTTCAAATC
 
. : . : . : . : . : . :
rJMSF027H11+ CTTCACCCCGGAATAATGTTGC-GGAAATGGTAGACCGTACAGTGTGAATTCATCCAACG
rJMSF025B09+ CTTCACCCCGGAATAATGTTGCGGGAAATGGTAGACCGTACAGTGTGAATTCATCCAACG
                      ____________________________________________________________
consensus CTTCACCCCGGAATAATGTTGCGGGAAATGGTAGACCGTACAGTGTGAATTCATCCAACG
 
. : . : . : . : . : . :
rJMSF027H11+ GTAATACGCCTGGTAGCAGTAGCAGCAATGTTAAGAACAGAAAGCAGCCTTCATCTCCCT
rJMSF025B09+ GTAATACGCCTGGTAGCAGTAGCAGCAATGTTAAGAACAGAAAGCAGCCTTCATCTCCCT
                      ____________________________________________________________
consensus GTAATACGCCTGGTAGCAGTAGCAGCAATGTTAAGAACAGAAAGCAGCCTTCATCTCCCT
 
. : . : . : . : . : . :
rJMSF027H11+ TTGGGAGCGGGAGCAATATCCATACGCTGAAACACGATGACGATAGTCAGTTTAGAGACG
rJMSF025B09+ TTGGGAGCGGGAGCAATATCCATACGCTGAAACACGATGACGATAGTCAGTTTAGAGACG
                      ____________________________________________________________
consensus TTGGGAGCGGGAGCAATATCCATACGCTGAAACACGATGACGATAGTCAGTTTAGAGACG
 
. : . : . : . : . : . :
rJMSF027H11+ GGAATGCATTCTGGAATGGAAATTCTACACAGTTTGGTGGCGGTAACAATGACAGTAAAT
rJMSF005J09+ GGAAATTNTACACAGTTTGGTGGCGGTAACAANGACAGTAAAT
rJMSF025B09+ GGAATGCATTCTGGAATGGAAATTCTACACAGTTTGGTGGCGGTAACAATGACAGTAAAT
                      ____________________________________________________________
consensus GGAATGCATTCTGGAATGGAAATTCTACACAGTTTGGTGGCGGTAACAATGACAGTAAAT
 
. : . : . : . : . : . :
rJMSF027H11+ GATGGTATCCATGCATTTTCTCATATGTACATGTGGGTTTGTATTTGGCCCTCGAGTATC
rJMSF005J09+ GATGGTATCCATGCNTTTTCTCATANNTACANGTGGGTTNGTATNNGGCCCTCGAGTATC
rJMSF025B09+ GATGGTATCCATGCATTTTCTCATATGTACATGTGGGTTTGTATTTGGCCCTCGAGTATC
                      ____________________________________________________________
consensus GATGGTATCCATGCATTTTCTCATATGTACATGTGGGTTTGTATTTGGCCCTCGAGTATC
 
. : . : . : . : . : . :
rJMSF027H11+ TGCTATACAGGCCCCCTCTTTGGTTCTT
rJMSF005J09+ TGCTATNCAGGCCCCCTCTTGGGTTCTTNTCTTCTAATNAAGTAATAANTGTNAAATAAA
rJMSF025B09+ TGCTATACAGGCCCCCTCTTTGGTTCTTTTCTTCTAATAAAGTAATAATTGTTAAATAAA
                      ____________________________________________________________
consensus TGCTATACAGGCCCCCTCTTTGGTTCTTTTCTTCTAATAAAGTAATAATTGTTAAATAAA
 
. : . : . : . : . : . :
rJMSF005J09+ GNTGATTCATTTATGTCGTCTCATNCTCAT
rJMSF025B09+ GATGATTTATTTATGTCGTCTCATACTCATTTTGAAATCATATAACAATGTAATTATATG
                      ____________________________________________________________
consensus GATGATTTATTTATGTCGTCTCATACTCATTTTGAAATCATATAACAATGTAATTATATG