Previous Contig 012386:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMSF025A10Sequence614012386 (6)gb:BT004819_16378534e-17Arabidopsis thaliana At3g58830 gene, complete cds.777012386 (6)gb:BT004819_16378535e-90Arabidopsis thaliana At3g58830 gene, complete cds.
JMSF045P20Sequence613012386 (6)gb:BT004819_16378536e-17Arabidopsis thaliana At3g58830 gene, complete cds.663012386 (6)gb:BT004819_16378534e-75Arabidopsis thaliana At3g58830 gene, complete cds.
JMSF046H04Sequence694012386 (6)gb:BT004819_16378532e-34Arabidopsis thaliana At3g58830 gene, complete cds.765012386 (6)gb:BT004819_16378537e-91Arabidopsis thaliana At3g58830 gene, complete cds.

Alignment

This contig is upended


. : . : . : . : . : . :
JMSF045P20- GCTCTCTTACCAATTGCCAATTGGTTGTC
JMSF025A10- GCTCTCTTACCAATTGCCAATTGGTTGTC
JMSF046H04- GGTTGTC
                      ____________________________________________________________
consensus GCTCTCTTACCAATTGCCAATTGGTTGTC
 
. : . : . : . : . : . :
JMSF045P20- CAAGAATGTGGTGGTGATGAAGATTTTGACATATTGTTTTGAAAGCCACACCCAACCCCC
JMSF025A10- CAAGAATGTGGTGGTGATGAAGATTTTGACATATTGTTTTGAAAGCCACACCCAACCCCC
JMSF046H04- CAAGAATGTGGTGGTGATGAAGATTTTGACATATTGTTTTGAAAGCCACACCCAACCCCC
                      ____________________________________________________________
consensus CAAGAATGTGGTGGTGATGAAGATTTTGACATATTGTTTTGAAAGCCACACCCAACCCCC
 
. : . : . : . : . : . :
JMSF045P20- ACTCCTCCCAAAACTCCCCATTTTGCAGATTCACAATTCACTTCTTGAATCCATGCTTTA
JMSF025A10- ACTCCTCCCAAAACTCCCCATTTTGCAGATTCACAATTCACTTCTTGAATCCATGCTTTA
JMSF046H04- ACTCCTCCCAAAACTCCCCATTTTGCAGATTCACAATTCACTTCTTGAATCCATGCTTTA
                      ____________________________________________________________
consensus ACTCCTCCCAAAACTCCCCATTTTGCAGATTCACAATTCACTTCTTGAATCCATGCTTTA
 
. : . : . : . : . : . :
JMSF045P20- TAAATTCAAACCTTTCTTAGTTTGACTATGCATTCTACCACTGTTACGCCATGGCAGAAC
JMSF025A10- TAAATTCAAACCTTTCTTAGTTTGACTATGCATTCTACCACTGTTACGCCATGGCAGAAC
JMSF046H04- TAAATTCAAACCTTTCTTAGTTTGACTATGCATTCTACCACTGTTACGCCATGGCAGAAC
                      ____________________________________________________________
consensus TAAATTCAAACCTTTCTTAGTTTGACTATGCATTCTACCACTGTTACGCCATGGCAGAAC
 
. : . : . : . : . : . :
JMSF045P20- TGCTGCTACTGTCCAGTTCCTAGCCGCTTTACCTCTCCCCCCCACTCTCTTCCTTTCCCC
JMSF025A10- TGCTGCTACTGTCCAGTTCCTAGCCGCTTTACCTCTCCCCCCCACTCTCTTCCTTTCCCC
JMSF046H04- TGCTGCTACTGTCCAGTTCCTAGCCGCTTTACCTCTCCCCCCCACTCTCTTCCTTTCCCC
                      ____________________________________________________________
consensus TGCTGCTACTGTCCAGTTCCTAGCCGCTTTACCTCTCCCCCCCACTCTCTTCCTTTCCCC
 
. : . : . : . : . : . :
JMSF045P20- ATCCGACTGAGCCGCCTCACTCTCAGCGCCGCCGCCACCACGCACAGCTGCAGCACCGAG
JMSF025A10- ATCCGACTGAGCCGCCTCACTCTCAGCGCCGCCGCCACCACGCACAGCTGCAGCACCGAG
JMSF046H04- ATCCGACTGAGCCGCCTCACTCTCAGCGCCGCCGCCACCACGCACAGCTGCAGCACCGAG
                      ____________________________________________________________
consensus ATCCGACTGAGCCGCCTCACTCTCAGCGCCGCCGCCACCACGCACAGCTGCAGCACCGAG
 
. : . : . : . : . : . :
JMSF045P20- CACGAGAAGCAAAAGCACCCCCGAAACCCCGAAGACCCGGATCGAGAAAACCCGGTGTTT
JMSF025A10- CACGAGAAGCAAAAGCACCCCCGAAACCCCGAAGACCCGGATCGAGAAAACCCGGTGTTT
JMSF046H04- CACGAGAAGCAAAAGCACCCCCGAAACCCCGAAGACCCGGATCGAGAAAACCCGGTGTTT
rJMSF046H04+ TTT
                      ____________________________________________________________
consensus CACGAGAAGCAAAAGCACCCCCGAAACCCCGAAGACCCGGATCGAGAAAACCCGGTGTTT
 
. : . : . : . : . : . :
JMSF045P20- CCTCAAGATTATTACGAAGACGGCGACGGAGAACCGGAAAGGCGATTCGAGAATCCTTTG
JMSF025A10- CCTCAAGATTATTACGAAGACGGCGACGGAGAACCGGAAAGGCGATTCGAGAATCCTTTG
JMSF046H04- CCTCAAGATTATTACGAAGACGGCGACGGAGAACCGGAAAGGCGATTCGAGAATCCTTTG
rJMSF046H04+ CCTCAAGATTATTACGAAGACGGCGACGGAGAACCGGAAAGGCGATTCGAGAATCCTTTG
                      ____________________________________________________________
consensus CCTCAAGATTATTACGAAGACGGCGACGGAGAACCGGAAAGGCGATTCGAGAATCCTTTG
 
. : . : . : . : . : . :
JMSF045P20- GTCTTTTTAACAAACATGTGGTGGGCAGACATGAAGGCTGCATTGGGGCAGAGGATTAAC
JMSF025A10- GTCTTTTTAACAAACATGTGGTGGGCAGACATGAAGGCTGCATTGGGGCAGAGGATTAAC
JMSF046H04- GTCTTTTTAACAAACATGTGGTGGGCAGACATGAAGGCTGCATTGGGGCAGAGGATTAAC
rJMSF046H04+ GTCTTTTTAACAAACATGTGGTGGGCAGACATGAAGGCTGCATTGGGGCAGAGGATTAAC
rJMSF025A10+ TTTTTAACCAACATGTGGTGGGCAGACATGAAGGCTGCATTGGGGCAGAGGATTAAC
                      ____________________________________________________________
consensus GTCTTTTTAACAAACATGTGGTGGGCAGACATGAAGGCTGCATTGGGGCAGAGGATTAAC
 
. : . : . : . : . : . :
JMSF045P20- GTGGAGGGTCTTACTTCTTCTCTGGGGATTTTTGCTAAAAACAAGCATTTGGTGATCCCA
JMSF025A10- GTGGAGGGTCTTACTTCTTCTCTGGGGATTTTTGCTAAAAACAAGCATTTGGTGATCCCA
JMSF046H04- GTGGAGGGTCTTACTTCTTCTCTGGGGATTTTTGCTAAAAACAAGCATTTGGTGATCCCA
rJMSF046H04+ GTGGAGGGTCTTACTTCTTCTCTGGGGATTTTTGCTAAAAACAAGCATTTGGTGATCCCA
rJMSF045P20+ CCA
rJMSF025A10+ GTGGAGGGTCTTACTTCTTCTCTGGGGATTTTTGCTAAAAACAAGCATTTGGTGATCCCA
                      ____________________________________________________________
consensus GTGGAGGGTCTTACTTCTTCTCTGGGGATTTTTGCTAAAAACAAGCATTTGGTGATCCCA
 
. : . : . : . : . : . :
JMSF045P20- CATATCGCTGTGCCGGATATAAGGTACATTGATTGGGCTGAGCT
JMSF025A10- CATATCGCTGTGCCGGATATAAGGTACATTGATTGGGCTGAGCTG
JMSF046H04- CATATCGCTGTGCCGGATATAAGGTACATTGATTGGGCTGAGCTGAAGAGAAGGGGCTTT
rJMSF046H04+ CATATCGCTGTGCCGGATATAAGGTACATTGATTGGGCTGAGCTGAAGAGAAGGGGCTTT
rJMSF045P20+ CATATCGCTGTGCCGGATATAAGGTACATTGATTGGGCTGAGCTGAAGAGAAGGGGCTTT
rJMSF025A10+ CATATCGCTGTGCCGGATATAAGGTACATTGATTGGGCTGAGCTGAAGAGAAGGGGCTTT
                      ____________________________________________________________
consensus CATATCGCTGTGCCGGATATAAGGTACATTGATTGGGCTGAGCTGAAGAGAAGGGGCTTT
 
. : . : . : . : . : . :
JMSF046H04- GAAGGTGTGGTCTTCGATAAGGACAATACTTTAACTGTTCCTTACTCTTTGCGCTTGTGG
rJMSF046H04+ GAAGGTGTGGTCTTCGATAAGGACAATACTTTAACTGTTCCTTACTCTTTGCGCTTGTGG
rJMSF045P20+ GAAGGTGTGGTCTTCGATAAGGACAATACTTTAACTGTTCCTTACTCTTTGCGCTTGTGG
rJMSF025A10+ GAAGGTGTGGTCTTCGATAAGGACAATACTTTAACTGTTCCTTACTCTTTGCGCTTGTGG
                      ____________________________________________________________
consensus GAAGGTGTGGTCTTCGATAAGGACAATACTTTAACTGTTCCTTACTCTTTGCGCTTGTGG
 
. : . : . : . : . : . :
JMSF046H04- CCGCCTCTGAGATCGTCCATAGAGCA
rJMSF046H04+ CCGCCTCTGAGATCGTCCATAGAGCAGTGCAAAGCTCTGTTTGGCAACAACATTGCGGTT
rJMSF045P20+ CCGCCTCTGAGATCGTCCATAGAGCAGTGCAAAGCTCTGTTTGGCAACAACATTGCGGTT
rJMSF025A10+ CCGCCTCTGAGATCGTCCATAGAGCAGTGCAAAGCTCTGTTTGGCAACAACATTGCGGTT
                      ____________________________________________________________
consensus CCGCCTCTGAGATCGTCCATAGAGCAGTGCAAAGCTCTGTTTGGCAACAACATTGCGGTT
 
. : . : . : . : . : . :
rJMSF046H04+ TTCAGTAACTCTGCAGGACTATTTGAATATGACCCTGATGGTAGAAATGCAAAGATCCTT
rJMSF045P20+ TTCAGTAACTCTGCAGGACTATTTGAATATGACCCTGATGGTAGAAATGCAAAGATCCTT
rJMSF025A10+ TTCAGTAACTCTGCAGGACTATTTGAATATGACCCTGATGGTAGAAATGCAAAGATCCTT
                      ____________________________________________________________
consensus TTCAGTAACTCTGCAGGACTATTTGAATATGACCCTGATGGTAGAAATGCAAAGATCCTT
 
. : . : . : . : . : . :
rJMSF046H04+ GAGCGTGCAATTGGAATTAAAGTAATCAGACATAGGGTGAAGAAACCAGCTGGAACAGCT
rJMSF045P20+ GAGCGTGCAATTGGAATTAAAGTAATCAGACATAGGGTGAAGAAACCAGCTGGAACAGCT
rJMSF025A10+ GAGCGTGCAATTGGAATTAAAGTAATCAGACATAGGGTGAAGAAACCAGCTGGAACAGCT
                      ____________________________________________________________
consensus GAGCGTGCAATTGGAATTAAAGTAATCAGACATAGGGTGAAGAAACCAGCTGGAACAGCT
 
. : . : . : . : . : . :
rJMSF046H04+ GAAGAAATTGAAAGGCAGTTTGGTTGCGAATCCTCAAAACTTATCATGGTGGGTGATCGG
rJMSF045P20+ GAAGAAATTGAAAGGCAGTTTGGTTGCGAATCCTCAAAACTTATCATGGTGGGTGATCGG
rJMSF025A10+ GAAGAAATTGAAAGGCAGTTTGGTTGCGAATCCTCAAAACTTATCATGGTGGGTGATCGG
                      ____________________________________________________________
consensus GAAGAAATTGAAAGGCAGTTTGGTTGCGAATCCTCAAAACTTATCATGGTGGGTGATCGG
 
. : . : . : . : . : . :
rJMSF046H04+ CCTTTCACAGACATTGTGTATGGAAACAGAAATGGCTTCCTAACTATTTTGACTGAACCA
rJMSF045P20+ CCTTTCACAGACATTGTGTATGGAAACAGAAATGGCTTCCTAACTATTTTGACTGAACCA
rJMSF025A10+ CCTTTCACAGACATTGTGTATGGAAACAGAAATGGCTTCCTAACTATTTTGACTGAACCA
                      ____________________________________________________________
consensus CCTTTCACAGACATTGTGTATGGAAACAGAAATGGCTTCCTAACTATTTTGACTGAACCA
 
. : . : . : . : . : . :
rJMSF046H04+ TTGAGTCTTGCTGAGGAGCCTTTCATTGTACAGCAGGTCAGGGTAATTGAAAGGGCACTT
rJMSF045P20+ TTGAGTCTTGCTGAGGAGCCTTTCATTGTACAGCAGGTCAGGGTAATTGAAAGGGCACTT
rJMSF025A10+ TTGAGTCTTGCTGAGGAGCCTTTCATTGTACAGCAGGTCAGGGTAATTGAAAGGGCACTT
                      ____________________________________________________________
consensus TTGAGTCTTGCTGAGGAGCCTTTCATTGTACAGCAGGTCAGGGTAATTGAAAGGGCACTT
 
. : . : . : . : . : . :
rJMSF046H04+ GTGTATCAGTGGTCGGTGAAAGGAGTGGAGCCAATCAGTCATGAACTCCTTCCTGATTGT
rJMSF045P20+ GTGTATCAGTGGTCGGTGAAAGGAGTGGAGCCAATCAGTCATGAACTCCTTCCTGATTGT
rJMSF025A10+ GTGTATCAGTGGTCGGTGAAAGGAGTGGAGCCAATCAGTCATGAACTCCTTCCTGATTGT
                      ____________________________________________________________
consensus GTGTATCAGTGGTCGGTGAAAGGAGTGGAGCCAATCAGTCATGAACTCCTTCCTGATTGT
 
. : . : . : . : . : . :
rJMSF046H04+ GAGCAATGTGTAAAGGATAAACCAAATTAGAAAGTAGAAGTT
rJMSF045P20+ GAGCAATGTGTAAAGGATAAACCAAATTAGAAAGTAGAAGTTTGTTTATGGCGATTAAGA
rJMSF025A10+ GAGCAATGTGTAAAGGATAAACCAAATTAGAAAGTAGAAGTTTGTTTATGGCGATTAAGA
                      ____________________________________________________________
consensus GAGCAATGTGTAAAGGATAAACCAAATTAGAAAGTAGAAGTTTGTTTATGGCGATTAAGA
 
. : . : . : . : . : . :
rJMSF045P20+ AAAATCATCTCATTAACAACTATCATTTTTGTCACTATTGGTAGTTTGTATATGAAAAGG
rJMSF025A10+ AAAATCATCTCATTAACAACTATCATTTTTGTCACTATTGGTAGTTTGTATATGAAAAGG
                      ____________________________________________________________
consensus AAAATCATCTCATTAACAACTATCATTTTTGTCACTATTGGTAGTTTGTATATGAAAAGG