Previous Contig 012375:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMSF024L19Sequence682012375 (2)gb:AY088440_15734592e-64Arabidopsis thaliana clone 6694 mRNA, complete sequence.748012375 (2)gb:ATAC021640_15437502e-17Arabidopsis thaliana chromosome III BAC F16B3 genomic sequence, complete sequenc

Alignment

This contig is upended


. : . : . : . : . : . :
JMSF024L19- GTAAATAAGCAATAGCGAAACTTAGCGCGTGCGGCGAG
                      ____________________________________________________________
consensus GTAAATAAGCAATAGCGAAACTTAGCGCGTGCGGCGAG
 
. : . : . : . : . : . :
JMSF024L19- TAAACGACGGCGAAGCAGGTGGCTGCGAATCTGCGGCACAGACTACTCCGGCGGAGCAAT
                      ____________________________________________________________
consensus TAAACGACGGCGAAGCAGGTGGCTGCGAATCTGCGGCACAGACTACTCCGGCGGAGCAAT
 
. : . : . : . : . : . :
JMSF024L19- GGTCGGAGTTCTCTCTCATAAGATCCAAAAAGATCAACTGAATCCGGGGGATCACGTTTA
                      ____________________________________________________________
consensus GGTCGGAGTTCTCTCTCATAAGATCCAAAAAGATCAACTGAATCCGGGGGATCACGTTTA
 
. : . : . : . : . : . :
JMSF024L19- CTCATGGAGGCACAACTATCTCTATGCTCATCACGGGATATATGTTGGTGATGGAAAGGT
                      ____________________________________________________________
consensus CTCATGGAGGCACAACTATCTCTATGCTCATCACGGGATATATGTTGGTGATGGAAAGGT
 
. : . : . : . : . : . :
JMSF024L19- TATTCATTTCACACGGGCTGCAGGTCATGAGATTGGAACAGGAACTGTCTTAGACAGCTT
                      ____________________________________________________________
consensus TATTCATTTCACACGGGCTGCAGGTCATGAGATTGGAACAGGAACTGTCTTAGACAGCTT
 
. : . : . : . : . : . :
JMSF024L19- TCTTTTCAGCTCTTCACCTGTGGAGCCCTTAGACCCCCCATGCCCAAGATGTGGTGATCA
                      ____________________________________________________________
consensus TCTTTTCAGCTCTTCACCTGTGGAGCCCTTAGACCCCCCATGCCCAAGATGTGGTGATCA
 
. : . : . : . : . : . :
JMSF024L19- ATCAGTGACTGAAGGTGTAATCGTATCCTGCCTTGAATGTTTTCTTTATGGTGGGGAACT
                      ____________________________________________________________
consensus ATCAGTGACTGAAGGTGTAATCGTATCCTGCCTTGAATGTTTTCTTTATGGTGGGGAACT
 
. : . : . : . : . : . :
JMSF024L19- CTATATTTTTCAGTACGGTGTTTCTCCAGCTTTTTTTCTTGCCAAAGTTCGAGGAGGAAC
                      ____________________________________________________________
consensus CTATATTTTTCAGTACGGTGTTTCTCCAGCTTTTTTTCTTGCCAAAGTTCGAGGAGGAAC
 
. : . : . : . : . : . :
JMSF024L19- GTGCTCACTTGCCCGGTCTGATCCAATGGAGCAGGTACTTCATCGAGCTGAATATCTGCT
                      ____________________________________________________________
consensus GTGCTCACTTGCCCGGTCTGATCCAATGGAGCAGGTACTTCATCGAGCTGAATATCTGCT
 
. : . : . : . : . : . :
JMSF024L19- TCAGAATGGTTTTGGGGTTTACAACCTGTTTAAGAACAACTGTGAGGATTTCGCAATCTA
rJMSF024L19+ AGAACAACTGTGAGGATTTCGCAATCTA
                      ____________________________________________________________
consensus TCAGAATGGTTTTGGGGTTTACAACCTGTTTAAGAACAACTGTGAGGATTTCGCAATCTA
 
. : . : . : . : . : . :
JMSF024L19- CTGCAAGACTGGTTTGCTTGTCTATACAGATCTAAGTGTAGGCCGGAGTGGACAGGCAGC
rJMSF024L19+ CTGCAAGACTGGTTTGCTTGTCTATACAGATCTAAGTGTAGGCCGGAGTGGACAGGCAGC
                      ____________________________________________________________
consensus CTGCAAGACTGGTTTGCTTGTCTATACAGATCTAAGTGTAGGCCGGAGTGGACAGGCAGC
 
. : . : . : . : . : . :
JMSF024L19- TTCCGTTTTAGCAGCTGTGAGTGTAATCGCCTCATCACCGCTTC
rJMSF024L19+ TTCCGTTTTAGCAGCTGTGAGTGTAATCGCCTCATCACCGCTTCGTTTCTTGACTACCGG
                      ____________________________________________________________
consensus TTCCGTTTTAGCAGCTGTGAGTGTAATCGCCTCATCACCGCTTCGTTTCTTGACTACCGG
 
. : . : . : . : . : . :
rJMSF024L19+ CATTGGTGGTCTGTCAGCCGTGGGATGTGGCATTTATTGTGTCAGCCGGATTGTTTCTGA
                      ____________________________________________________________
consensus CATTGGTGGTCTGTCAGCCGTGGGATGTGGCATTTATTGTGTCAGCCGGATTGTTTCTGA
 
. : . : . : . : . : . :
rJMSF024L19+ TATTGGAGTGCGTCGGGATGTCACAAAGATACACGTGGAAAAGCTCGTTGCCCGTTTTAG
                      ____________________________________________________________
consensus TATTGGAGTGCGTCGGGATGTCACAAAGATACACGTGGAAAAGCTCGTTGCCCGTTTTAG
 
. : . : . : . : . : . :
rJMSF024L19+ CCCAGGCCTGGCTGAGTCTAGAGCTGGAACGTCTGATAGCCAAGTGCGTGATGGTTTTCC
                      ____________________________________________________________
consensus CCCAGGCCTGGCTGAGTCTAGAGCTGGAACGTCTGATAGCCAAGTGCGTGATGGTTTTCC
 
. : . : . : . : . : . :
rJMSF024L19+ AAAGACACCAGTCGAGAGTCCAATTGGCCACTCTAGCCCTGACCCTGAGCCTGAAACTGC
                      ____________________________________________________________
consensus AAAGACACCAGTCGAGAGTCCAATTGGCCACTCTAGCCCTGACCCTGAGCCTGAAACTGC
 
. : . : . : . : . : . :
rJMSF024L19+ AACATCCATCTAACAGTGTAGTATGTGACAACATCACAAAGAGTATTGCCACAGGCTCTA
                      ____________________________________________________________
consensus AACATCCATCTAACAGTGTAGTATGTGACAACATCACAAAGAGTATTGCCACAGGCTCTA
 
. : . : . : . : . : . :
rJMSF024L19+ GCGTTTCTGAGTCTGAAGCTGAAAGATCTGATAGCGGAGCCTGCTGTGATCTCACCATCG
                      ____________________________________________________________
consensus GCGTTTCTGAGTCTGAAGCTGAAAGATCTGATAGCGGAGCCTGCTGTGATCTCACCATCG
 
. : . : . : . : . : . :
rJMSF024L19+ AGAGGCTTGCCATTTGTCAATTGGTCTAGCCTGCCCGAGACGAAAGCTGGAACTGATGCT
                      ____________________________________________________________
consensus AGAGGCTTGCCATTTGTCAATTGGTCTAGCCTGCCCGAGACGAAAGCTGGAACTGATGCT
 
. : . : . : . : . : . :
rJMSF024L19+ GAAAAGGAGTCGTAATTCTTGTTGTGTGTGTTATATATGTATTCTGCGTGTGTATGTAGT
                      ____________________________________________________________
consensus GAAAAGGAGTCGTAATTCTTGTTGTGTGTGTTATATATGTATTCTGCGTGTGTATGTAGT
 
. : . : . : . : . : . :
rJMSF024L19+ GCTCATCTCCATAGCCTGTAAGCCTGCCTGCATGGCTATTAGGCACATCAGAGTGAGTAA
                      ____________________________________________________________
consensus GCTCATCTCCATAGCCTGTAAGCCTGCCTGCATGGCTATTAGGCACATCAGAGTGAGTAA
 
. : . : . : . : . : . :
rJMSF024L19+ GTTTTTGTGATATAATTATGATATTGACATAAGTGTACTGTCATTAGTGATCTAGTGAGA
                      ____________________________________________________________
consensus GTTTTTGTGATATAATTATGATATTGACATAAGTGTACTGTCATTAGTGATCTAGTGAGA