Previous Contig 012366:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMSF011P24Sequence252018747732012366 (3)gb:AY535423_16123134e-89Lycopersicon esculentum WAK-like kinase mRNA, complete cds.
JMSF024I19Sequence638019354gb:AY535423_16123132e-27Lycopersicon esculentum WAK-like kinase mRNA, complete cds.780012366 (3)gb:AY535423_16123133e-91Lycopersicon esculentum WAK-like kinase mRNA, complete cds.
JMSF037O10Sequence556012366 (3)gb:AY535423_16123133e-39Lycopersicon esculentum WAK-like kinase mRNA, complete cds.

Alignment

This contig is upended


. : . : . : . : . : . :
rJMSF024I19+ C
                      ____________________________________________________________
consensus C
 
. : . : . : . : . : . :
rJMSF011P24+ ATTTGCAATGACAGATGACTCCCACATTTCCA
rJMSF024I19+ GAAGATAGCTGATTTCNGGGCTCTCGAGATTTGCAATGACAGATGACTCCCACATTTCCA
                      ____________________________________________________________
consensus GAAGATAGCTGATTTCNGGGCTCTCGAGATTTGCAATGACAGATGACTCCCACATTTCCA
 
. : . : . : . : . : . :
rJMSF011P24+ CAGCACCGCAAGGGACCCCGGGCTACTTAGACCCTCAGTACCATCAAAATTACCATCTTT
rJMSF024I19+ CAGCACCGCAAGGGACCCCGGGCTACTTAGACCCTCAGTACCATCAAAATTACCATCTTT
                      ____________________________________________________________
consensus CAGCACCGCAAGGGACCCCGGGCTACTTAGACCCTCAGTACCATCAAAATTACCATCTTT
 
. : . : . : . : . : . :
rJMSF011P24+ CTGACAAGAGCGACGTGTACAGCTTTGGGGTCGTGCTCGTGGAGATCATAACAGCTAAGA
rJMSF024I19+ CTGACAAGAGCGACGTGTACAGCTTTGGGGTCGTGCTCGTGGAGATCATAACAGCTAAGA
                      ____________________________________________________________
consensus CTGACAAGAGCGACGTGTACAGCTTTGGGGTCGTGCTCGTGGAGATCATAACAGCTAAGA
 
. : . : . : . : . : . :
rJMSF037O10+ CACACCGAGATCAACNTGGCAGCCCTGGCAATAGACA
rJMSF011P24+ AAGTCGTGGACTTCTCCCGCCCCCACACCGAGATCAACCTGGCAGCCCTGGCAATCGACA
rJMSF024I19+ AAGTCGTGGACTTCTCCCGCCCCCACACCGAGATCAACCTGGCAGCCCTGGCAATCGACA
                      ____________________________________________________________
consensus AAGTCGTGGACTTCTCCCGCCCCCACACCGAGATCAACCTGGCAGCCCTGGCAATCGACA
 
. : . : . : . : . : . :
rJMSF037O10+ GGATTGGGAAAGGGCACATGGACGANATAATCGATCCATATCTCGAGCCACATAGGGACG
rJMSF011P24+ GGATTGGGAAAGGGCACATGGACGAGATAATCGATCCATATCTCGAGCCACATAGGGACG
rJMSF024I19+ GGATTGGGAAAGGGCACATGGACGAGATAATCGATCCATATCTCGAGCCACATAGGGACG
                      ____________________________________________________________
consensus GGATTGGGAAAGGGCACATGGACGAGATAATCGATCCATATCTCGAGCCACATAGGGACG
 
. : . : . : . : . : . :
rJMSF037O10+ CCTGGACACTTTCATCGATCCACAGGGTAGCGGAGCTGGCTTTCAGATGCCTCGCGTTCC
rJMSF011P24+ CCTGGACACTTTCATCGATCCACAGGGTAGCGGAGCTGGCTTTCAGATGCCTCGCGTTCC
rJMSF024I19+ CCTGGACACTTTCATCGATCCACAGGGTAGCGGAGCTGGCTTTCAGATGCCTCGCGTTCC
                      ____________________________________________________________
consensus CCTGGACACTTTCATCGATCCACAGGGTAGCGGAGCTGGCTTTCAGATGCCTCGCGTTCC
 
. : . : . : . : . : . :
rJMSF037O10+ ACAAGGACATGAGCCCCTCAATGACAGAAGTGGCAGATGAACTGGAGCAAATCAGGNTCA
rJMSF011P24+ ACAAGGACATGAGGCCCTCAATGACAGAAGTGGCAGATGAACTGGAGCAAATCAGGCTCA
rJMSF024I19+ ACAAGGACATGAGGCCCTCAATGACAGAAGTGGCAGATGAACTGGAGCAAATCAGGCTCA
                      ____________________________________________________________
consensus ACAAGGACATGAGGCCCTCAATGACAGAAGTGGCAGATGAACTGGAGCAAATCAGGCTCA
 
. : . : . : . : . : . :
rJMSF037O10+ GCGCTTGGGCTCCTGTNGAGGAAAACGTATGCANGANGTCCTCNGTCGCCTCGTCTTNCT
rJMSF011P24+ GCGCTTGGGCTCCTGTCGAGGAAAACGTATGCATGACGTCCTCAGTCGCCTCGTCTTGCT
rJMSF024I19+ GCGCTTGGGCTCCTGTCGAGGAAAACGTATGCATGACGTCCTCAGTCGCCTCGTCTTGCT
                      ____________________________________________________________
consensus GCGCTTGGGCTCCTGTCGAGGAAAACGTATGCATGACGTCCTCAGTCGCCTCGTCTTGCT
 
. : . : . : . : . : . :
rJMSF037O10+ CCTCCCCACGCAATGGCAGCGAGAAATCGTTTGGTAGTTNGANTNAGAAAGGCGNGGTGG
rJMSF011P24+ CCTCCCCACGCAATGGCAGCGAGAAATCGTTTGGTAGTTCGACTAAGAAAGGCGGGGTGG
rJMSF024I19+ CCTCCCCACGCAATGGCAGCGAGAAATCGTTTGGTAGTTCGACTAAGAAAGGCGGGGTGG
                      ____________________________________________________________
consensus CCTCCCCACGCAATGGCAGCGAGAAATCGTTTGGTAGTTCGACTAAGAAAGGCGGGGTGG
 
. : . : . : . : . : . :
rJMSF037O10+ GAAGTAGGAGGGTGATCCTCCCCCAGAAAGTCATCATTGNCCTGTCTNCCATGGAGGAAA
rJMSF011P24+ GAAGTAGGAGGGTGATCCTCCCCCAGAAAGTCATCATTGGCCTGTCTGCCATGGAGGAAA
rJMSF024I19+ GAAGTAGGAGGGTGATCCTCCCCCAGAAAGTCATCATTGGCCTGTCTGCCATGGAGGAAA
                      ____________________________________________________________
consensus GAAGTAGGAGGGTGATCCTCCCCCAGAAAGTCATCATTGGCCTGTCTGCCATGGAGGAAA
 
. : . : . : . : . : . :
rJMSF037O10+ TTANGGATAGTTCTCCAGTTTCTGTGCNGGATCCATGNTCAAGTAAGGNCAGTTCTCCAG
rJMSF011P24+ TTAAGGATAGTTCTCCAGTTTCTGTGCAGGATCCATGGTCAAGTAAGGACAGTTCTCCAG
rJMSF024I19+ TTAAGGATAGTTCTCCAGTTTCTGTGCAGGATCCATGGTCAAGTAAGGACAGTTCTCCAG
                      ____________________________________________________________
consensus TTAAGGATAGTTCTCCAGTTTCTGTGCAGGATCCATGGTCAAGTAAGGACAGTTCTCCAG
 
. : . : . : . : . : . :
rJMSF037O10+ CCAATACCTTAGCTGGGTAAATGAAACTGCTAGTNTAGAGTTTAGACACAACAA--TATA
rJMSF011P24+ CCAATACCTTA-CTGGGTAAATGAAACTGCTAGTTTAGAGTTTAGACACAACAATCTCTA
rJMSF024I19+ CCAATACCTTA-CTGGGTAAATGAAACTGCTAGTTTAGAGTTTAGACACAACAATCTCTA
                      ____________________________________________________________
consensus CCAATACCTTA-CTGGGTAAATGAAACTGCTAGTTTAGAGTTTAGACACAACAATCTCTA
 
. : . : . : . : . : . :
rJMSF037O10+ TATATATATATAGCTGGCCTGTATCTACTAGTATATT
rJMSF011P24+ TATATATATATAGCTGGCCTGTATCTACTAGTATATT
rJMSF024I19+ TATATATATATAGCTGGCCTGTATCTACTAGTATATTTGAAGCTAAACACCAAACCAAGT
                      ____________________________________________________________
consensus TATATATATATAGCTGGCCTGTATCTACTAGTATATTTGAAGCTAAACACCAAACCAAGT