Previous Contig 012365:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF006M16Sequence563004225 (18)gb:AF353094_17905409e-05Arabidopsis thaliana BEL1-like homeodomain 1 (BLH1) mRNA, complete cds.785012365 (8)gb:AF406702_17969102e-35Solanum tuberosum BEL1-related homeotic protein 29 (Bel29) mRNA, partial cds.
JMFF023B23Sequence522004225 (18)gb:AF353094_17905409e-06Arabidopsis thaliana BEL1-like homeodomain 1 (BLH1) mRNA, complete cds.577012365 (8)gb:AF406702_17969103e-21Solanum tuberosum BEL1-related homeotic protein 29 (Bel29) mRNA, partial cds.
JMFF029N01Sequence485004225 (18)gb:AF353094_17905402e-04Arabidopsis thaliana BEL1-like homeodomain 1 (BLH1) mRNA, complete cds.731012365 (8)gb:AF406702_17969103e-34Solanum tuberosum BEL1-related homeotic protein 29 (Bel29) mRNA, partial cds.
JMFF046H19Sequence573004225 (18)gb:AF353094_17905405e-06Arabidopsis thaliana BEL1-like homeodomain 1 (BLH1) mRNA, complete cds.334012365 (8)
JMFN006K10Sequence627012365 (8)gb:AF406702_17969106e-39Solanum tuberosum BEL1-related homeotic protein 29 (Bel29) mRNA, partial cds.
JMFS037E01Sequence596012365 (8)gb:AF406702_17969109e-15Solanum tuberosum BEL1-related homeotic protein 29 (Bel29) mRNA, partial cds.
JMSF024I18Sequence648004225 (18)gb:AF353094_17905407e-06Arabidopsis thaliana BEL1-like homeodomain 1 (BLH1) mRNA, complete cds.785012365 (8)gb:AF406702_17969102e-32Solanum tuberosum BEL1-related homeotic protein 29 (Bel29) mRNA, partial cds.
JMSF045I20Sequence646004225 (18)gb:AF353094_17905407e-06Arabidopsis thaliana BEL1-like homeodomain 1 (BLH1) mRNA, complete cds.758012365 (8)gb:AF406702_17969102e-33Solanum tuberosum BEL1-related homeotic protein 29 (Bel29) mRNA, partial cds.

Alignment

This contig is upended


. : . : . : . : . : . :
JMFN006K10- CAGGTTTCAACCTCATTGGACCCTCATAAATGGAAAGCATTACTCA-GGGAAGT-CCAAA
rJMFF029N01+ TCAGAAATGGAAAGCATTANTCA-GGGAAGT-CCAAA
rJMSF045I20+ GGAAAGCATTACTCAGGGGAAGTCCCAAA
rJMFF006M16+ AAATGGAAAGCATTANTCA-GGGAAGT-CCAAA
rJMSF024I18+ T-CCAAN
                      ____________________________________________________________
consensus CAGGTTTCAACCTCATTGGACCCTCATAAATGGAAAGCATTACTCA-GGGAAGT-CCAAA
 
. : . : . : . : . : . :
JMFN006K10- GAAGCCGCGGGGGGGCTCAGACATGCCCGCTCTCATGAAATTTGGCAACGACAGGCAAAA
rJMFF029N01+ GAAGCCGCGGGGGGGNTCAGACATGCCCGNTNTCATGAAATTTGGCAACGACAGGCAAAA
rJMSF045I20+ GAAGCCGCGGGGGGGCTCAGACATGCCCGCTCTCATGAAATTTGGCAACGACAGGCAAAA
rJMFF006M16+ GAAGCCGCGGGGGGGCTCAGACATGCCCGCTTTCATGAAATTTGGCAACGACAGGCAAAA
rJMSF024I18+ GAAGCCGCGGGGGGGNTCAGACATGCCCGCTCTCATGAAATTTGGCAACGACAGGCCAAA
                      ____________________________________________________________
consensus GAAGCCGCGGGGGGGCTCAGACATGCCCGCTCTCATGAAATTTGGCAACGACAGGCAAAA
 
. : . : . : . : . : . :
JMFN006K10- CCGAGAAGGATTCCCCTTGGTGGAGGGATCAACAAACTTCATGGCCGCCTTCGGCTCCTA
rJMFF023B23+ TCCTA
rJMFF029N01+ CCGAGAAGGATTCCCCTTGGTGGAGGGATCAACAAACTTCATGGCCGCCTTCGGCTCCTA
rJMSF045I20+ CCGAGAAGGATTCCCCTTGGTGGAGGGATCAACAAACTTCATGGCCGCCTTCGGCTCCTA
rJMFF006M16+ CCGAGAAGGATTCCCCTTGGTGGAGGGATCAACAAACTTCATGGCCGCCTTCGGCTCCTA
rJMSF024I18+ CCGAGAAGGATTCCCCTTGGTGGAGGGATCAACAAACTTCATGGCCGCCTTCGGCTCCTA
                      ____________________________________________________________
consensus CCGAGAAGGATTCCCCTTGGTGGAGGGATCAACAAACTTCATGGCCGCCTTCGGCTCCTA
 
. : . : . : . : . : . :
JMFN006K10- CCCAATGGAGCAAATGGGGCGGTTCACCACCGAGCAATTCCCCCCGCCTTATTCCACCAA
rJMFF023B23+ CCCAATGGAGCAAATGGGGCGGTTCACCACCGAGCAATTCCCCCCGCCTTATTCCACCAA
rJMFF029N01+ CCCAATGGAGCAAATGGGGCGGTTCACCACCGAGCAATTCCCCCCGCCTTATTCCACCAA
rJMSF045I20+ CCCAATGGAGCAAATGGGGCGGTTCACCACCGAGCAATTCCCCCCGCCTTATTCCACCAA
JMFS037E01+ CGGTTCACCACCGAGCAATTCCCGCCGCCTT-TTCCACCAA
rJMFF006M16+ CCCAATGGAGCAAATGGGGCGGTTCACCACCGAGCAATTCCCCCCGCCTTATTCCACCAA
rJMSF024I18+ CCCAATGGAGCAAATGGGGCGGTTCACCACCGAGCAATTCCCCCCGCCTTATTCCACCAA
                      ____________________________________________________________
consensus CCCAATGGAGCAAATGGGGCGGTTCACCACCGAGCAATTCCCCCCGCCTTATTCCACCAA
 
. : . : . : . : . : . :
JMFN006K10- CGCTGTCTCCCTAACCCTCGGCCTGCAGCACAGCGAAAACCTCTCCGCCGCCATGTCTGC
rJMFF023B23+ CGCTGTNTCCCTAACCCTCGGCCTGCAGCACAGCGAAAACCTNTCCGCCGCCATGTTTGC
rJMFF029N01+ CGCTGTCTCCCTAACCCTCGGCCTGCAGCACAGNGAAAACCTNTCCGCCGCCATGTTTGC
rJMSF045I20+ CGCTGTCTCCCTAACCCTCGGCCTGCAGCACAGCGAAAACCTCTCCGCCGCCATGTCTGC
JMFS037E01+ CGCTGTCTCCCTAACCCTCGGCCTGCAGCACAGCGAAAACCTCTCCGCCGCCATGTATGC
rJMFF006M16+ CGCTGTCTCCCTAACCCTCGGCCTGCAGCACAGCGAAAACCTCTCCGCCGCCATGTCTGC
rJMSF024I18+ CGCTGTCTCCCTAACCCTCGGCCTGCAGCACAGCGAAAACCTCTCCGCCGCCATGTCTGC
                      ____________________________________________________________
consensus CGCTGTCTCCCTAACCCTCGGCCTGCAGCACAGCGAAAACCTCTCCGCCGCCATGTCTGC
 
. : . : . : . : . : . :
JMFN006K10- CACACACCACAATTTCCTCCCCAATCAAATGGGAAGGGGAGTCGTGATTGGTGAAGCCGA
rJMFF023B23+ CACACACCACAATTTCCTCCCCAATCAAATGGGAAGGGGAGTNGTGATTGGTGAAGCCGA
rJMFF029N01+ CACACACCACAATTTCCTCCCCAATCAAATGGGAAGGGGAGTCGTGATTGGTGAAGCCGA
rJMSF045I20+ CACACACCACAATTTCCTCCCCAATCAAATGGGAAGGGGAGTCGTGATTGGTGAAGCCGA
JMFS037E01+ CACACACCACAATTTCCTCCCCAATCAAATGGGAAGGGGAGTCGTGATTGGTGAAGCCGA
rJMFF006M16+ CACACACCACAATTTCCTCCCCAATCAAATGGGAAGGGGAGTCGTGATTGGTGAAGCCGA
rJMSF024I18+ CACACACCACAATTTCCTCCCCAATCAAATGGGAAGGGGAGTCGTGATTGGTGAAGCCGA
                      ____________________________________________________________
consensus CACACACCACAATTTCCTCCCCAATCAAATGGGAAGGGGAGTCGTGATTGGTGAAGCCGA
 
. : . : . : . : . : . :
JMFN006K10- AGCAAATGATTTCGTCGCTGGAATGACCACTCCGACATCTGCTCACCCCACCAGCGTGTT
rJMFF023B23+ AGCAAATGATTTNGTCGCTGGAATGACCACTCCGACATNTGCTCACCCCACCAGCGTGTT
rJMFF029N01+ AGCAAATGATTTCGTCGCTGGAATGACCACTCCGACATNTGCTCACCCCACCAGCGTGTT
rJMSF045I20+ AGCAAATGATTTCGTCGCTGGAATGACCACTCCGACATCTGCTCACCCCACCAGCGTGTT
JMFS037E01+ AGCAAATGATTTCGTCGCTGGAATGACCACTCCGACATGTGCTCACCCCACCAGCGTGTT
rJMFF006M16+ AGCAAATGATTTCGTCGCTGGAATGACCACTCCGACATCTGCTCACCCCACCAGCGTGTT
rJMSF024I18+ AGCAAATGATTTCGTCGCTGGAATGACCACTCCGACATCTGCTCACCCCACCAGCGTGTT
                      ____________________________________________________________
consensus AGCAAATGATTTCGTCGCTGGAATGACCACTCCGACATCTGCTCACCCCACCAGCGTGTT
 
. : . : . : . : . : . :
JMFN006K10- CGACAACTTCAACATCCAAAACCGCAAGAGGTTCCCTGCACAATTGTTGCCAGACTTTGT
rJMFF023B23+ NGACAACTTCAACATCCAAAACCGCAAGAGGTTCCCTGCACAATTGTTGCCAGACTTTGT
rJMFF029N01+ CGACAACTTCAACATCCAAAACCGCAAGAGGTTCCCTGCACAATTGTTGCCAGACTTTGT
rJMSF045I20+ CGACAACTTCAACATCCAAAACCGCAAGAGGTTCCCTGCACAATTGTTGCCAGACTTTGT
rJMFF046H19+ AACATCCAAAACCGCAAGAGGTTCCCTGCACAATTGTTGCCAGACTTTGT
JMFS037E01+ CGACAACTTCAACATCCAAAACCGCAAGAGGTTCCCTGCACAATTGTTGCCAGACTTTGT
rJMFF006M16+ CGACAACTTCAACATCCAAAACCGCAAGAGGTTCCCTGCACAATTGTTGCCAGACTTTGT
rJMSF024I18+ CGACAACTTCAACATCCAAAACCGCAAGAGGTTCCCTGCACAATTGTTGCCAGACTTTGT
                      ____________________________________________________________
consensus CGACAACTTCAACATCCAAAACCGCAAGAGGTTCCCTGCACAATTGTTGCCAGACTTTGT
 
. : . : . : . : . : . :
JMFN006K10- CACCTGATCGAGTTTAAGGTTGTCTGCAGGGTCCTCCTCTTTGTCTGATCTTCATCACTA
rJMFF023B23+ CACCTGATNGAGTTTAAGGTTGTNTGCAGGGTCCTCCTNTTTGTNTGATNTTCATCACTA
rJMFF029N01+ CACCTGATCGAGTTTAAGGTTGTNTGCAGGGTCCTCCTCTTTGTNTGATCTTCATCACTA
rJMSF045I20+ CACCTGATCGAGTTTAAGGTTGTCTGCAGGGTCCTCCTCTTTGTCTGATCTTCATCACTA
rJMFF046H19+ CCCCTGATTGAGTTTAAGGTTGTTTGCAGGGTCCTCCTCTTTGTTTGATTTTCATCACTA
JMFS037E01+ CACCTGATCGAGTTTAAGGTTGTCTGCAGGGTCCTCCTCTTTGTCTGATCTTCATCACTA
rJMFF006M16+ CACCTGATCGAGTTTAAGGTTGTCTGCAGGGTCCTCCTCTTTGTCTGATCTTCATCACTA
rJMSF024I18+ CACCTGATCGAGTTTAAGGTTGTCTGCAGGGTCCTCCTCTTTGTCTGATCTTCATCACTA
                      ____________________________________________________________
consensus CACCTGATCGAGTTTAAGGTTGTCTGCAGGGTCCTCCTCTTTGTCTGATCTTCATCACTA
 
. : . : . : . : . : . :
JMFN006K10- TTTTCTTCCATTTCCCAAAACTATTAGGAAGAACGACATTTCATTATGGTTAGTGCAAAC
rJMFF023B23+ TTTTNTTCCATTTCCCAAAACTATTAGGAAGAACGACATTTCATTATGGTTAGTGCAAAC
rJMFF029N01+ TTTTNTTCCATTTCCCAAAACTATTAGGAAGAACGACATTTCATTATGGTTAGTGCAAAC
rJMSF045I20+ TTTTCTTCCATTTCCCAAAACTATTAGGAAGAACGACATTTCATTATGGTTAGTGCAAAC
rJMFF046H19+ TTTTTTTCCATTTCCCAAAACTTTTTGGAAGAACGGCATTTCATTATGGTTAGTGCAAAC
JMFS037E01+ TTTTCTTCCATTTCCCAAAACTATTAGGAAGAACGACATTTCATTATGGTTAGTGCAAAC
rJMFF006M16+ TTTTCTTCCATTTCCCAAAACTATTAGGAAGAACGACATTTCATTATGGTTAGTGCAAAC
rJMSF024I18+ TTTTCTTCCATTTCCCAAAACTATTAGGAAGAACGACATTTCATTATGGTTAGTGCAAAC
                      ____________________________________________________________
consensus TTTTCTTCCATTTCCCAAAACTATTAGGAAGAACGACATTTCATTATGGTTAGTGCAAAC
 
. : . : . : . : . : . :
JMFN006K10- AACCTTGAAAAAC-AAAAAAAAATTAAAAG
rJMFF023B23+ AACCTTGAAAAACAAAAAAAAAATTAAAAGCTTTTACATAGTACAGGTCTACACTTTGCA
rJMFF029N01+ AACCTTGAAAAACAAAAAAAAAATTAAAAGCTTTTACATAGTACAGGTCTACACTTTGCA
rJMSF045I20+ AACCTTGAAAAAC-AAAAAAAAATTAAAAGCTTTTACATAGTACAGGTCTACACTTTGCA
rJMFF046H19+ AACCTTGAAAAACAAAAAAAAAATTAAAAGCTTTTTCATAGTTCAGGTTTTCCCTTTGCA
JMFS037E01+ AACCTTGAAAAAC-AAAAAAAAATTAAAAGCTTTTACATAGTACAGGTCTACACTTTGCA
rJMFF006M16+ AACCTTGAAAAAC-AAAAAAAAATTAAAAGCTTTTACATAGTACAGGTCTACACTTTGCA
rJMSF024I18+ AACCTTGAAAAAC-AAAAAAAAATTAAAAGCTTTTACATAGTACAGGTCTACACTTTGCA
                      ____________________________________________________________
consensus AACCTTGAAAAAC-AAAAAAAAATTAAAAGCTTTTACATAGTACAGGTCTACACTTTGCA
 
. : . : . : . : . : . :
rJMFF023B23+ GAAGAACCACTAGAGTTCTTATGGATAGTTTAGGCTTTTAGAAGATGTGGTTGAGGATTG
rJMFF029N01+ GAAGAACCACTAGAGTTCTTATGGATAGTTTAGGCTTTTAGAAGATGTGGTTGAGGATTG
rJMSF045I20+ GAAGAACCACTAGAGTTCTTATGGATAGTTTAGGCTTTTAGAAGATGTGGTTGAGGATTG
rJMFF046H19+ GAAGAACCCCTAGAGTTTTTATGGATAGTTTAGGCTTTTAGAAGAAGTGGTTGAGGATTG
JMFS037E01+ GAAGAACCACTAGAGTTCTTATGGATAGTTTAGGCTTTTAGAAGATGTGGTTGAGGATTG
rJMFF006M16+ GAAGAACCACTAGAGTTCTTATGGATAGTTTAGGCTTTTAGAAGATGTGGTTGAGGATTG
rJMSF024I18+ GAAGAACCACTAGAGTTCTTATGGATAGTTTAGGCTTTTAGAAGATGTGGTTGAGGATTG
                      ____________________________________________________________
consensus GAAGAACCACTAGAGTTCTTATGGATAGTTTAGGCTTTTAGAAGATGTGGTTGAGGATTG
 
. : . : . : . : . : . :
rJMFF023B23+ TATATTAATTTTGTTGTTGCAGATAAGATAAT
rJMFF029N01+ TATATTAATTTTGTTGTTGCAGATAAGATAATT
rJMSF045I20+ TATATTAATTTTGTTGTTGCAGATAAGATAATTGGATTGTTATATTGGA
rJMFF046H19+ TATATTAATTTTGTTGTTGCAGATAAGATAATTGGATTGTTATA
JMFS037E01+ TATATTAATTTTGTTGTTGCAGATAAGATAATTGGATTGTTATATTGGA
rJMFF006M16+ TATATTAATTTTGTTGTTGCAGATAAGATAATTGGATTGTTATATTGGATGTGGAAAAAC
rJMSF024I18+ TATATTAATTTTGTTGTTGCAGATAAGATAATTGGATTGTTATATTGGATGTGGAAAAAC
                      ____________________________________________________________
consensus TATATTAATTTTGTTGTTGCAGATAAGATAATTGGATTGTTATATTGGATGTGGAAAAAC
 
. : . : . : . : . : . :
rJMFF006M16+ ACATAATTTGGGATGGTATAGAAGAAGATAA
rJMSF024I18+ ACATAATTTGGGATGGTATAGAAGAAGATAATGTTAAGTTTCATTGCTATCAGAACAATT
                      ____________________________________________________________
consensus ACATAATTTGGGATGGTATAGAAGAAGATAATGTTAAGTTTCATTGCTATCAGAACAATT