Previous Contig 012361:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMSF008L09Sequence480007447 (4)gb:AP002071_18219553e-60Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 6, PAC clone:P067755012361 (3)gb:AP005260_18497639e-24Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 7, PAC clone:P055
JMSF024H15Sequence671012361 (3)gb:AP005260_18497635e-39Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 7, PAC clone:P055749012361 (3)gb:AP005260_18497631e-22Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 7, PAC clone:P055

Alignment

This contig is upended


. : . : . : . : . : . :
JMSF024H15- GAGTTGATGCAAGAATCACTGAGCAGGACCTTAGGGAT
                      ____________________________________________________________
consensus GAGTTGATGCAAGAATCACTGAGCAGGACCTTAGGGAT
 
. : . : . : . : . : . :
JMSF024H15- CAGTTTTATGCACATGGTGAAATTGAGTCCGTAAAAATGGTGTTGCAACGTGGATGTGCT
rJMSF008L09+ GTGGATGTGCT
                      ____________________________________________________________
consensus CAGTTTTATGCACATGGTGAAATTGAGTCCGTAAAAATGGTGTTGCAACGTGGATGTGCT
 
. : . : . : . : . : . :
JMSF024H15- TTCGTAACATATACAACAAGGGAAGGTGCCGAGAGGGCAGCTGAGGAACTTGCAAACAAG
rJMSF008L09+ TTCGTAACATATACAACAAGGGAAGGTGCCGAGAGGGCAGCTGAGGAACTTGCAAACAAG
rJMSF024H15+ AGAGGGCAGCTGAGGAACTTGCAAACAAG
                      ____________________________________________________________
consensus TTCGTAACATATACAACAAGGGAAGGTGCCGAGAGGGCAGCTGAGGAACTTGCAAACAAG
 
. : . : . : . : . : . :
JMSF024H15- CTTGTAATAAAGGGCTTGCGGTTGAAATTACTGTGGGGAAGACCACAGGCACCAAAGCCT
rJMSF008L09+ CTTGTAATAAAGGGCTTGCGGTTGAAATTACTGTGGGGAAGACCACAGGCACCAAAGCCT
rJMSF024H15+ CTTGTAATAAAGGGCTTGCGGTTGAAATTACTGTGGGGAAGACCACAGGCACCAAAGCCT
                      ____________________________________________________________
consensus CTTGTAATAAAGGGCTTGCGGTTGAAATTACTGTGGGGAAGACCACAGGCACCAAAGCCT
 
. : . : . : . : . : . :
JMSF024H15- GAATCTGAGATGACCGATGAGTTGAGGCAGCAGGCGGCGGTGGCTCATAGTGGGTTGCTG
rJMSF008L09+ GAATCTGAGATGACCGATGAGTTGAGGCAGCAGGCGGCGGTGGCTCATAGTGGGTTGCTG
rJMSF024H15+ GAATCTGAGATGACCGATGAGTTGAGGCAGCAGGCGGCGGTGGCTCATAGTGGGTTGCTG
                      ____________________________________________________________
consensus GAATCTGAGATGACCGATGAGTTGAGGCAGCAGGCGGCGGTGGCTCATAGTGGGTTGCTG
 
. : . : . : . : . : . :
JMSF024H15- CCAAGGGCCGTCATATCACAGCAACAGAACCAGCCCGATAACCAAGATCAACCTCCATAC
rJMSF008L09+ CCAAGGGCCGTCATATCACAGCAACAGAACCAGCCCGATAACCAAGATCAACCTCCATAC
rJMSF024H15+ CCAAGGGCCGTCATATCACAGCAACAGAACCAGCCCGATAACCAAGATCAACCTCCATAC
                      ____________________________________________________________
consensus CCAAGGGCCGTCATATCACAGCAACAGAACCAGCCCGATAACCAAGATCAACCTCCATAC
 
. : . : . : . : . : . :
JMSF024H15- ATGCCTTACTTCAACATTCCGCATATGCCTCAGCCCGAGAGAGCGTTTTATCCTTCAATG
rJMSF008L09+ ATGCCTTACTTCAACATTCCGCATATGCCTCAGCCCGAGAGAGCGTTTTATCCTTCAATG
rJMSF024H15+ ATGCCTTACTTCAACATTCCGCATATGCCTCAGCCCGAGAGAGCGTTTTATCCTTCAATG
                      ____________________________________________________________
consensus ATGCCTTACTTCAACATTCCGCATATGCCTCAGCCCGAGAGAGCGTTTTATCCTTCAATG
 
. : . : . : . : . : . :
JMSF024H15- GATCCTCAAAGGATGGGAGCCCTTGTTTCTTCCCAAGATGGGAGTTCAAATGCTGGAGCT
rJMSF008L09+ GATCCTCAAAGGATGGGAGCCCTTGTTTCTTCCCAAGATGGGAGTTCAAATGCTGGAGCT
rJMSF024H15+ GATCCTCAAAGGATGGGAGCCCTTGTTTCTTCCCAAGATGGGAGTTCAAATGCTGGAGCT
                      ____________________________________________________________
consensus GATCCTCAAAGGATGGGAGCCCTTGTTTCTTCCCAAGATGGGAGTTCAAATGCTGGAGCT
 
. : . : . : . : . : . :
JMSF024H15- TCAGGATCAGGTGAAAATAGAAGTGGTCCTGACCAGCAACCACAAGGACAACATTTCGGT
rJMSF008L09+ TCAGGATCAGGTGAAAATAGAAGTGGTCCTGACCAGCAACCACAAGGACAACATTTCGGT
rJMSF024H15+ TCAGGATCAGGTGAAAATAGAAGTGGTCCTGACCAGCAACCACAAGGACAACATTTCGGT
                      ____________________________________________________________
consensus TCAGGATCAGGTGAAAATAGAAGTGGTCCTGACCAGCAACCACAAGGACAACATTTCGGT
 
. : . : . : . : . : . :
JMSF024H15- TATCCACCCGCCCCACAACAACCTCAAGGTCAATTTTACCGGCCTTATTATCCACCCATT
rJMSF008L09+ TATCCACCCGCCCCACAACAACCTCAAGGTCAATTTTACCGGCCTTATTATCCACCCATT
rJMSF024H15+ TATCCACCCGCCCCACAACAACCTCAAGGTCAATTTTACCGGCCTTATTATCCACCCATT
                      ____________________________________________________________
consensus TATCCACCCGCCCCACAACAACCTCAAGGTCAATTTTACCGGCCTTATTATCCACCCATT
 
. : . : . : . : . : . :
JMSF024H15- CCGCCCTATGGCTACATCCCTCCCCCTTCACCACCTTATCAGCAGTTTCCTCCACCACCC
rJMSF008L09+ CCGCCCTATGGCTACATCCCTCCCCCTTCACCACCTTATCAGCAGTTTCCTCCACCACCC
rJMSF024H15+ CCGCCCTATGGCTACATCCCTCCCCCTTCACCACCTTATCAGCAGTTTCCTCCACCACCC
                      ____________________________________________________________
consensus CCGCCCTATGGCTACATCCCTCCCCCTTCACCACCTTATCAGCAGTTTCCTCCACCACCC
 
. : . : . : . : . : . :
JMSF024H15- TACCAGGCTATGATCCCTCCACCGCCTCCCGGT
rJMSF008L09+ TACCAGGCTATGATCCCTCCACCGCCTCCCGGTGGCAACACAACAGGACATCAACCGCCA
rJMSF024H15+ TACCAGGCTATGATCCCTCCACCGCCTCCCGGTGGCAACACAACAGGACATCAACCGCCA
                      ____________________________________________________________
consensus TACCAGGCTATGATCCCTCCACCGCCTCCCGGTGGCAACACAACAGGACATCAACCGCCA
 
. : . : . : . : . : . :
rJMSF008L09+ CACACCGGACCAGCTCAGCAAGGAACTGGACAACAAGATCCTGGACAGCAATTTTAGTTT
rJMSF024H15+ CACACCGGACCAGCTCAGCAAGGAACTGGACAACAAGATCCTGGACAGCAATTTTAGTTT
                      ____________________________________________________________
consensus CACACCGGACCAGCTCAGCAAGGAACTGGACAACAAGATCCTGGACAGCAATTTTAGTTT
 
. : . : . : . : . : . :
rJMSF008L09+ CATTGGTATGGTCACATGTTTGGGACAAATATCTGCAGCTGAAAGCTTAAAACCATTGCT
rJMSF024H15+ CATTGGTATGGTCACATGTTTGGGACAAATATCTGCAGCTGAAAGCTTAAAACCATTGCT
                      ____________________________________________________________
consensus CATTGGTATGGTCACATGTTTGGGACAAATATCTGCAGCTGAAAGCTTAAAACCATTGCT
 
. : . : . : . : . : . :
rJMSF008L09+ AGCTGCCAAAAGTTAAAATCTTTC
rJMSF024H15+ AGCTGCCAAAAGTTAAAATCTTTCTGTGTTTTTCCATTCAATTAAATGAATAGATTCTGT
                      ____________________________________________________________
consensus AGCTGCCAAAAGTTAAAATCTTTCTGTGTTTTTCCATTCAATTAAATGAATAGATTCTGT