Previous Contig 012359:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMSF024G23Sequence669006218 (2)gb:AP003270_18268819e-65Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, PAC clone:P050780012359 (2)gb:AP003270_18268812e-38Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, PAC clone:P050
JMSF025G23Sequence609006218 (2)gb:AP003270_18268813e-59Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, PAC clone:P050759012359 (2)gb:AP003270_18268811e-37Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, PAC clone:P050

Alignment

This contig is upended


. : . : . : . : . : . :
rJMSF025G23+ TGATCGCACTGTTTCTGGTTATGACCCTCGCAGATGGGCGACACTGTCAAGGTGGT
rJMSF024G23+ GAGNTGATCGCACTGTTTCTGTTTATGACCCTCGCAGATGGGCGACACTGTCAAGGTGGT
                      ____________________________________________________________
consensus GAGNTGATCGCACTGTTTCTGTTTATGACCCTCGCAGATGGGCGACACTGTCAAGGTGGT
 
. : . : . : . : . : . :
rJMSF025G23+ TGAACTGTTCAAAATATGAGATAACAAGACTTGCTTTCTCATCAGTCGATTCAGATTACA
rJMSF024G23+ TGAACTGTTCAAAATATGAGATAACAAGACTTGCTTTCTCATCAGTCGATTCAGATTACA
                      ____________________________________________________________
consensus TGAACTGTTCAAAATATGAGATAACAAGACTTGCTTTCTCATCAGTCGATTCAGATTACA
 
. : . : . : . : . : . :
rJMSF025G23+ TCTATGTGCAAGGAGTAGATTATGAGGTTCTCTGTGGACAGTGGAGAGATGGCAAGAAAG
rJMSF024G23+ TCTATGTGCAAGGAGTAGATTATGAGGTTCTCTGTGGACAGTGGAGAGATGGCAAGAAAG
                      ____________________________________________________________
consensus TCTATGTGCAAGGAGTAGATTATGAGGTTCTCTGTGGACAGTGGAGAGATGGCAAGAAAG
 
. : . : . : . : . : . :
rJMSF025G23+ CGTTTTCATTTAGAGGAGATTCAAATTGGCTTGGGTTCAACAAGTGTTCTGACAGGGACC
rJMSF024G23+ CGTTTTCATTTAGAGGAGATTCAAATTGGCTTGGGTTCAACAAGTGTTCTGACAGGGACC
                      ____________________________________________________________
consensus CGTTTTCATTTAGAGGAGATTCAAATTGGCTTGGGTTCAACAAGTGTTCTGACAGGGACC
 
. : . : . : . : . : . :
rJMSF025G23+ TTGTGGGGGGATGGTGCGATTCAGGGAGCTTGTTTGTGGCCGATGTTTGCAGGAAGAACA
rJMSF024G23+ TTGTGGGGGGATGGTGCGATTCAGGGAGCTTGTTTGTGGCCGATGTTTGCAGGAAGAACA
                      ____________________________________________________________
consensus TTGTGGGGGGATGGTGCGATTCAGGGAGCTTGTTTGTGGCCGATGTTTGCAGGAAGAACA
 
. : . : . : . : . : . :
rJMSF025G23+ AATCACTCGCGGAAAATTTAGATTCATCTAATGGAAATGCACTCTTGATCTCTTAATCGA
rJMSF024G23+ AATCACTCGCGGAAAATTTAGATTCATCTAATGGAAATGCACTCTTGATCTCTTAATCGA
                      ____________________________________________________________
consensus AATCACTCGCGGAAAATTTAGATTCATCTAATGGAAATGCACTCTTGATCTCTTAATCGA
 
. : . : . : . : . : . :
rJMSF025G23+ TTCTTCACTTCACATCCAAAGATATGTCAGATCTTTGCAACATTATCAAGAACAATCATC
rJMSF024G23+ TTCTTCACTTCACATCCAAAGATATGTCAGATCTTTGCAACATTATCAAGAACAATCATC
                      ____________________________________________________________
consensus TTCTTCACTTCACATCCAAAGATATGTCAGATCTTTGCAACATTATCAAGAACAATCATC
 
. : . : . : . : . : . :
rJMSF025G23+ ACTCCGGTTTTTCTGTCAGCACCGCAATGCTAGGGGCAGAATTGGAAACGCAACAAAAAC
rJMSF024G23+ ACTCCGGTTTTTCTGTCAGCACCGCAATGCTAGGGGCAGAATTGGAAACGCAACAAAAAC
                      ____________________________________________________________
consensus ACTCCGGTTTTTCTGTCAGCACCGCAATGCTAGGGGCAGAATTGGAAACGCAACAAAAAC
 
. : . : . : . : . : . :
rJMSF025G23+ CTTCTTCAGCCCTCAACTGGTGCAGCATATCAGCATGCAAGGTGAGCCACTGAGCCCCCA
rJMSF024G23+ CTTCTTCAGCCCTCAACTGGTGCAGCATATCAGCATGCAAGGTGAGCCACTGAGCCCCCA
                      ____________________________________________________________
consensus CTTCTTCAGCCCTCAACTGGTGCAGCATATCAGCATGCAAGGTGAGCCACTGAGCCCCCA
 
. : . : . : . : . : . :
rJMSF025G23+ TAGTTTTGTATGCAGTCAGTCCCAGATTCTCATTCAACTGAAGTGAAAAGACTTTCTTGT
rJMSF024G23+ TAGTTTTGTATGCAGTCAGTCCCAGATTCTCATTCAACTGAAGTGAAAAGACTTTCTTGT
                      ____________________________________________________________
consensus TAGTTTTGTATGCAGTCAGTCCCAGATTCTCATTCAACTGAAGTGAAAAGACTTTCTTGT
 
. : . : . : . : . : . :
rJMSF025G23+ CCTCCTTGTGGTGCTGCTAGTGTTCCATCAGGCTAAATTATAGGAACTTTAACTAAATGC
rJMSF024G23+ CCTCCTTGTGGTGCTGCTAGTGTTCCATCAGGCTAAATTATAGGAACTTTAACTAAATGC
                      ____________________________________________________________
consensus CCTCCTTGTGGTGCTGCTAGTGTTCCATCAGGCTAAATTATAGGAACTTTAACTAAATGC
 
. : . : . : . : . : . :
rJMSF025G23+ TGTACTAATACTTACTCTGATAGTCAGATCTCCACTTCAATCAGCAGAAATTTATGGCTT
rJMSF024G23+ TGTACTAATACTTACTCTGATAGTCAGATCTCCACTTCAATCAGCAGAAATTTATGGCTT
                      ____________________________________________________________
consensus TGTACTAATACTTACTCTGATAGTCAGATCTCCACTTCAATCAGCAGAAATTTATGGCTT
 
. : . : . : . : . : . :
rJMSF025G23+ TTTTGAAGCAGCAGTCAAAATGGATAGTCCTTGCAACCTT
rJMSF024G23+ TTTTGAAGCAGCAGTCAAAATGGATAGTCCTTGCAACCTTGAAATTTTACCCTTTGTGTG
                      ____________________________________________________________
consensus TTTTGAAGCAGCAGTCAAAATGGATAGTCCTTGCAACCTTGAAATTTTACCCTTTGTGTG