Previous Contig 012344:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMSF011B08Sequence226005205 (2)745012344 (2)gb:AY035074_15598461e-21Arabidopsis thaliana putative polygalacturonase (At3g16850) mRNA, complete cds.>
JMSF024C05Sequence690005205 (2)gb:AY085702_15707695e-60Arabidopsis thaliana clone 17203 mRNA, complete sequence.810012344 (2)gb:AY035074_15598465e-29Arabidopsis thaliana putative polygalacturonase (At3g16850) mRNA, complete cds.>

Alignment

This contig is upended


. : . : . : . : . : . :
rJMSF024C05+ TTACNTGCANGATTCCCTCGNGGGAATTGA
                      ____________________________________________________________
consensus TTACNTGCANGATTCCCTCGNGGGAATTGA
 
. : . : . : . : . : . :
rJMSF011B08+ TCTATTCTCGGGGGTAGT
rJMSF024C05+ GCTGAAGACAGCTAGAGGACGGGGCGGTTATATCGAGGACATTCTATTCTCGGGGGTAGT
                      ____________________________________________________________
consensus GCTGAAGACAGCTAGAGGACGGGGCGGTTATATCGAGGACATTCTATTCTCGGGGGTAGT
 
. : . : . : . : . : . :
rJMSF011B08+ GATGGAAAATGTTCGGGTGGGAATCAATGCTACGAGTTACTATGACACGCATCCAGATGA
rJMSF024C05+ GATGGAAAATGTTCGGGTGGGAATCAATGCTACGAGTTACTATGACACGCATCCAGATGA
                      ____________________________________________________________
consensus GATGGAAAATGTTCGGGTGGGAATCAATGCTACGAGTTACTATGACACGCATCCAGATGA
 
. : . : . : . : . : . :
rJMSF011B08+ CGAGTTTGATCCTAATGCACTTCCAGCGGTCGGTAATATCACCTTCAAGGACATTATTGG
rJMSF024C05+ CGAGTTTGATCCTAATGCACTTCCAGCGGTCGGTAATATCACCTTCAAGGACATTATTGG
                      ____________________________________________________________
consensus CGAGTTTGATCCTAATGCACTTCCAGCGGTCGGTAATATCACCTTCAAGGACATTATTGG
 
. : . : . : . : . : . :
rJMSF011B08+ CACGAATATCTCCATAGCCGGAAATTTCAAGGGATTACCTGAATCGCCCTTCACTTCCAT
rJMSF024C05+ CACGAATATCTCCATAGCCGGAAATTTCAAGGGATTACCTGAATCGCCCTTCACTTCCAT
                      ____________________________________________________________
consensus CACGAATATCTCCATAGCCGGAAATTTCAAGGGATTACCTGAATCGCCCTTCACTTCCAT
 
. : . : . : . : . : . :
rJMSF011B08+ ATGCCTTTCAGATATCTCCTTTTCCATCTCGCCCGACCATTCAACCCCGTGGATATGCTC
rJMSF024C05+ ATGCCTTTCAGATATCTCCTTTTCCATCTCGCCCGACCATTCAACCCCGTGGATATGCTC
                      ____________________________________________________________
consensus ATGCCTTTCAGATATCTCCTTTTCCATCTCGCCCGACCATTCAACCCCGTGGATATGCTC
 
. : . : . : . : . : . :
rJMSF011B08+ TGACGTTTCGGGTCTTTCCTCAAACGTGTCACCCGAACCATGCCCCGAGCTTCAGAACCC
rJMSF024C05+ TGACGTTTCGGGTCTTTCCTCAAACGTGTCACCCGAACCATGCCCCGAGCTTCAGAACCC
                      ____________________________________________________________
consensus TGACGTTTCGGGTCTTTCCTCAAACGTGTCACCCGAACCATGCCCCGAGCTTCAGAACCC
 
. : . : . : . : . : . :
rJMSF011B08+ GGTTTCCAGTATATCTACTTCAGCTTGTTTCCCCCTGCTACAATCTTATAATCAAGTTGC
rJMSF024C05+ GGTTTCCAGTATATCTACTTCAGCTTGTTTCTCCCTGCTACAATCTTATAATCAAGTTGC
                      ____________________________________________________________
consensus GGTTTCCAGTATATCTACTTCAGCTTGTTTCTCCCTGCTACAATCTTATAATCAAGTTGC
 
. : . : . : . : . : . :
rJMSF011B08+ AATCTTATAATCCCTCTGCATAGAACTTATTCAATGCATTGAATCTCTACAACGAGAGAC
rJMSF024C05+ AATCTTATAATCCCTCTGCATAGAACTTATTCAATGCATTGAATCTCTACAACGAGAGAC
                      ____________________________________________________________
consensus AATCTTATAATCCCTCTGCATAGAACTTATTCAATGCATTGAATCTCTACAACGAGAGAC
 
. : . : . : . : . : . :
rJMSF011B08+ CTATTCTTTGCCGGTGTATAATCTTCCAATAAGATGCGAGCTAGAATTGCAAGTCAAGAT
rJMSF024C05+ CTATTCTTTGCCGGTGTATAATCTTCCAATAAGATGCGAGCTAGAATTGCAAGTCAAGAT
                      ____________________________________________________________
consensus CTATTCTTTGCCGGTGTATAATCTTCCAATAAGATGCGAGCTAGAATTGCAAGTCAAGAT
 
. : . : . : . : . : . :
rJMSF011B08+ CGAGCTCAGGCAGGTATATTCTTCAAAGTGGCATTACATTATTATTATTATTTTCTGTAC
rJMSF024C05+ CGAGCTCAGGCAGGTATATTCTTCAAAGTGGCATTACATTATTATTATTATTTTCTGTAC
                      ____________________________________________________________
consensus CGAGCTCAGGCAGGTATATTCTTCAAAGTGGCATTACATTATTATTATTATTTTCTGTAC
 
. : . : . : . : . : . :
rJMSF011B08+ AGCATTGGTTCCTATTTCATCATGTGTAAGAAAAGTTTTGGTAGTGCAGTACATTCACAT
rJMSF024C05+ AGCATTGGTTCCTATTTCATCATGTGTAAGAAAAGTTTTGGTAGTGCAGTACATTCACAT
                      ____________________________________________________________
consensus AGCATTGGTTCCTATTTCATCATGTGTAAGAAAAGTTTTGGTAGTGCAGTACATTCACAT
 
. : . : . : . : . : . :
rJMSF011B08+ ATACGTTGTTCCTTTGGCTGTTCATTTTTCATTTTTACTTTCTACTCCCATCTTACATTT
rJMSF024C05+ ATACGTTGTTCCTTTGGCTGTTCATTTTTCATTTTTACTTTCTACTCCCATCTTACATTT
                      ____________________________________________________________
consensus ATACGTTGTTCCTTTGGCTGTTCATTTTTCATTTTTACTTTCTACTCCCATCTTACATTT
 
. : . : . : . : . : . :
rJMSF011B08+ GTAAATGTGGATATGGAAACCGCTCATGATTGTTTGGTGTTAGATTGTGCTGAAAGTGT
rJMSF024C05+ GTAAATGTGGATATGGAAACCGCTCATGATTGTTTGGTGTTAGATTGTGCTGAAAGTGTT
                      ____________________________________________________________
consensus GTAAATGTGGATATGGAAACCGCTCATGATTGTTTGGTGTTAGATTGTGCTGAAAGTGTT