Previous Contig 012343:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMSF024C02Sequence639006196 (2)sp|Q9LXX6|SC15_ARATH2e-30Probable exocyst complex component Sec15.>pir|T49065|T49065 hypothetical protein720012343 (2)sp|Q9LXX6|SC15_ARATH7e-77Probable exocyst complex component Sec15.>pir|T49065|T49065 hypothetical protein
JMSF026H08Sequence615006196 (2)sp|Q9LXX6|SC15_ARATH6e-30Probable exocyst complex component Sec15.>pir|T49065|T49065 hypothetical protein765012343 (2)sp|Q9LXX6|SC15_ARATH7e-81Probable exocyst complex component Sec15.>pir|T49065|T49065 hypothetical protein

Alignment

This contig is upended


. : . : . : . : . : . :
rJMSF026H08+ AGGCAGTTAACTGCCNAGATGNTCTCAAAACTTCTAGGGATGCTGC
                      ____________________________________________________________
consensus AGGCAGTTAACTGCCNAGATGNTCTCAAAACTTCTAGGGATGCTGC
 
. : . : . : . : . : . :
rJMSF026H08+ TTATCTTGCTTTGTTAAGCTTGGTAAACGACAAGTTGGAAGAGTTCATGTCACTCACAGA
rJMSF024C02+ TTATCTTGCTTTGTTAAGCTTGGTAAACGACAAGNTGGAAGAGTTCATGTCACTCACAGA
                      ____________________________________________________________
consensus TTATCTTGCTTTGTTAAGCTTGGTAAACGACAAGTTGGAAGAGTTCATGTCACTCACAGA
 
. : . : . : . : . : . :
rJMSF026H08+ AAACGTGAACTGGACGGTAGAAGATGCTCCCCAGGGAGGAAATGAGTATATTAACGAGGT
rJMSF024C02+ AAACGTGAACTGGACGGTAGAAGATGCTCCCCAGGGAGGAAATGAGTATATTAACGAGGT
                      ____________________________________________________________
consensus AAACGTGAACTGGACGGTAGAAGATGCTCCCCAGGGAGGAAATGAGTATATTAACGAGGT
 
. : . : . : . : . : . :
rJMSF026H08+ GCTTATTTACCTCGACACCCTTATGTCCACTGCTCAGCAAATTTTGCCTCTTGATGCTTT
rJMSF024C02+ GCTTATTTACCTCGACACCCTTATGTCCACTGCTCAGCAAATTTTGCCTCTTGATGCTTT
                      ____________________________________________________________
consensus GCTTATTTACCTCGACACCCTTATGTCCACTGCTCAGCAAATTTTGCCTCTTGATGCTTT
 
. : . : . : . : . : . :
rJMSF026H08+ GTATAAAGTCGGGAGTGGTGCNCTCGAGCATATTTCCAACTCCNTTGTGGGAGCTTTTNT
rJMSF024C02+ GTATAAAGTCGGGAGTGGTGCACTCGAGCATATTTCCAACTCCATTGTGGGAGCTTTTCT
                      ____________________________________________________________
consensus GTATAAAGTCGGGAGTGGTGCACTCGAGCATATTTCCAACTCCATTGTGGGAGCTTTTCT
 
. : . : . : . : . : . :
rJMSF026H08+ TAGTGACGCTGTAAAAAGATTCAACGTTAATGTTGTGATGGGCATCAACCNAGATTTGAA
rJMSF024C02+ TAGTGACGCTGTAAAAAGATTCAACGTTAATGTTGTGATGGGCATCAACCNAGATTTGAA
                      ____________________________________________________________
consensus TAGTGACGCTGTAAAAAGATTCAACGTTAATGTTGTGATGGGCATCAACCNAGATTTGAA
 
. : . : . : . : . : . :
rJMSF026H08+ GGCNTTGGAATCTTTTGCTGATGAGAAGTTTCACAGCNCCGGGTTGAGCGAGATATACAG
rJMSF024C02+ GGCNTTGGAATCTTTTGCTGATGAGAAGTTTCACAGCNCCGGGTTGAGCGAGATATACAG
                      ____________________________________________________________
consensus GGCNTTGGAATCTTTTGCTGATGAGAAGTTTCACAGCNCCGGGTTGAGCGAGATATACAG
 
. : . : . : . : . : . :
rJMSF026H08+ CGAAGGAAGCTTCCGAGGATGCTTGATAGAGGCTAGACAATTGATAAACCTTCTGTTGAG
rJMSF024C02+ CGAAGGAAGCTTCCGAGGATGCTTGATAGAGGCTAGACAATTGATAAACCTTCTGTTGAG
                      ____________________________________________________________
consensus CGAAGGAAGCTTCCGAGGATGCTTGATAGAGGCTAGACAATTGATAAACCTTCTGTTGAG
 
. : . : . : . : . : . :
rJMSF026H08+ CNGTCAACCGGAGAACTTCATGAATCCTGTGATACGGCAGAGGAACTACTATTCTTTGGA
rJMSF024C02+ CNGTCAACCGGAGAACTTCATGAATCCTGTGATACGGCAGAGGAACTACTATTCTTTGGA
                      ____________________________________________________________
consensus CNGTCAACCGGAGAACTTCATGAATCCTGTGATACGGCAGAGGAACTACTATTCTTTGGA
 
. : . : . : . : . : . :
rJMSF026H08+ TTATAAAAGGGTTGCGACTATCTGTGACAAGTACAGGGACGCTGCTGATGGACTGTTCGG
rJMSF024C02+ TTATAAAAGGGTTGCGACTATCTGTGACAAGTACNGGGACGCTGCTGATGGACTGTTCGG
                      ____________________________________________________________
consensus TTATAAAAGGGTTGCGACTATCTGTGACAAGTACAGGGACGCTGCTGATGGACTGTTCGG
 
. : . : . : . : . : . :
rJMSF026H08+ AAGTCTTGCAAGAGGAAATACTAAGCAAAGTGCCCGTAAAAAATCCNTGGACNCGCTGAA
rJMSF024C02+ AAGTCTTGCAAGAGGAAATACTAAGCAAAGTGCCCGTAAAAAATCCNTGGACNCGCTGAA
                      ____________________________________________________________
consensus AAGTCTTGCAAGAGGAAATACTAAGCAAAGTGCCCGTAAAAAATCCNTGGACNCGCTGAA
 
. : . : . : . : . : . :
rJMSF026H08+ GAAAAGACTAAGGGATTTCAACTGAGAAATCGTAATATATGGATTAGAAAGTAGCTTCTT
rJMSF024C02+ GAAAAGACTAAGGGATTTCAACTGAGAAATCGTAATATATGGATTAGAAAGTAGCTTCTT
                      ____________________________________________________________
consensus GAAAAGACTAAGGGATTTCAACTGAGAAATCGTAATATATGGATTAGAAAGTAGCTTCTT
 
. : . : . : . : . : . :
rJMSF026H08+ TTTGTTTTTCCTTAATTTTTTTTTTGTGATTGAAAATAAA-CGAATTCTTTTATTTGCTG
rJMSF024C02+ TTTGTTTTTCCNTAATTTTTTTTTTGTGATTGAAAATAAACCGAATTCTTTTATTTGCTG
                      ____________________________________________________________
consensus TTTGTTTTTCCTTAATTTTTTTTTTGTGATTGAAAATAAACCGAATTCTTTTATTTGCTG