Previous Contig 012334:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMSF023P20Sequence678012334 (2)gb:AY049308_15619501e-67Arabidopsis thaliana At1g07080/F10K1_15 mRNA, complete cds.>gb:AY054145_1562967 720012334 (2)gb:AY049308_15619506e-67Arabidopsis thaliana At1g07080/F10K1_15 mRNA, complete cds.>gb:AY054145_1562967

Alignment

This contig is upended


. : . : . : . : . : . :
JMSF023P20- GATGGCTGCTCCAAAAAAATTGCATCTTCAACTAATCCTTCTTCTCAGCATCTGTT
                      ____________________________________________________________
consensus GATGGCTGCTCCAAAAAAATTGCATCTTCAACTAATCCTTCTTCTCAGCATCTGTT
 
. : . : . : . : . : . :
JMSF023P20- CTGTGTTATCTTGGAAGCCATGGCTGAGCTCTGCAAGTTCTGGGACTGTCTCCACTGAAG
                      ____________________________________________________________
consensus CTGTGTTATCTTGGAAGCCATGGCTGAGCTCTGCAAGTTCTGGGACTGTCTCCACTGAAG
 
. : . : . : . : . : . :
JMSF023P20- AAAAGGTCAAGCTAGAGCTCTACTATGAGACCCTGTGCCCATACTGCTCCAGATTCATAG
rJMSF023P20+ AAAAGGTCAAGCTAGAGCTCTACTATGAGACCCTGTGCCCATACTGCTCCAGATTCATAG
                      ____________________________________________________________
consensus AAAAGGTCAAGCTAGAGCTCTACTATGAGACCCTGTGCCCATACTGCTCCAGATTCATAG
 
. : . : . : . : . : . :
JMSF023P20- CCAAATATTTGCCACAGCTCTTCGATACTGGACTCATATCCATCACAGACCTCAGCTTCA
rJMSF023P20+ CCAAATATTTGCCACAGCTCTTCGATACTGGACTCATATCCATCACAGACCTCAGCTTCA
                      ____________________________________________________________
consensus CCAAATATTTGCCACAGCTCTTCGATACTGGACTCATATCCATCACAGACCTCAGCTTCA
 
. : . : . : . : . : . :
JMSF023P20- TCCCTTATGGCAACGCCAAAATCGGCCCCAACGCCACCATAACCTGTCAGCATGGTGAAT
rJMSF023P20+ TCCCTTATGGCAACGCCAAAATCGGCCCCAACGCCACCATAACCTGTCAGCATGGTGAAT
                      ____________________________________________________________
consensus TCCCTTATGGCAACGCCAAAATCGGCCCCAACGCCACCATAACCTGTCAGCATGGTGAAT
 
. : . : . : . : . : . :
JMSF023P20- ATGAATGCCTGTTGAACACTGTTGAGGCTTGTGCAATCGACGCCTGGCCAGATTTGAGCG
rJMSF023P20+ ATGAATGCCTGTTGAACACTGTTGAGGCTTGTGCAATCGACGCCTGGCCAGATTTGAGCG
                      ____________________________________________________________
consensus ATGAATGCCTGTTGAACACTGTTGAGGCTTGTGCAATCGACGCCTGGCCAGATTTGAGCG
 
. : . : . : . : . : . :
JMSF023P20- AGCACTTCCCCTTTATATATTGCGTCGAAAATCTGGTCTACGAGGGGAAGTATACAGCGT
rJMSF023P20+ AGCACTTCCCCTTTATATATTGCGTCGAAAATCTGGTCTACGAGGGGAAGTATACAGCGT
                      ____________________________________________________________
consensus AGCACTTCCCCTTTATATATTGCGTCGAAAATCTGGTCTACGAGGGGAAGTATACAGCGT
 
. : . : . : . : . : . :
JMSF023P20- GGGAAACATGTTTCGCGAATCTGGGCATGGATCCAACCCCTGTCACTGATTGCTCTGCCA
rJMSF023P20+ GGGAAACATGTTTCGCGAATCTGGGCATGGATCCAACCCCTGTCACTGATTGCTCTGCCA
                      ____________________________________________________________
consensus GGGAAACATGTTTCGCGAATCTGGGCATGGATCCAACCCCTGTCACTGATTGCTCTGCCA
 
. : . : . : . : . : . :
JMSF023P20- GTGGGCGCGGCAAAGAGCTTGAGTTGCAGTATGCAGCAGTGACAAATGCCCTTGAACCTC
rJMSF023P20+ GTGGGCGCGGCAAAGAGCTTGAGTTGCAGTATGCAGCAGTGACAAATGCCCTTGAACCTC
                      ____________________________________________________________
consensus GTGGGCGCGGCAAAGAGCTTGAGTTGCAGTATGCAGCAGTGACAAATGCCCTTGAACCTC
 
. : . : . : . : . : . :
JMSF023P20- CTCATACATATGTGCCATGGGTAGTCGTGGATGGGCAACCGCTATATGAGGACTATATGA
rJMSF023P20+ CTCATACATATGTGCCATGGGTAGTCGTGGATGGGCAACCGCTATATGAGGACTATATGA
                      ____________________________________________________________
consensus CTCATACATATGTGCCATGGGTAGTCGTGGATGGGCAACCGCTATATGAGGACTATATGA
 
. : . : . : . : . : . :
JMSF023P20- ACTTCATAAGCTATATCTGTAAAGCATACAAAGGAAGTACCAAAATCCCTGCTTGCAGTG
rJMSF023P20+ ACTTCATAAGCTATATCTGTAAAGCATACAAAGGAAGTACCAAAATCCCTGCTTGCAGTG
                      ____________________________________________________________
consensus ACTTCATAAGCTATATCTGTAAAGCATACAAAGGAAGTACCAAAATCCCTGCTTGCAGTG
 
. : . : . : . : . : . :
JMSF023P20- AATTGTCTGCCACTGTCAGCCA
rJMSF023P20+ AATTGTCTGCCACTGTCAGCCATTTGGGGATATTAAGGTTGTTGAATCCATTCTGGTAGT
                      ____________________________________________________________
consensus AATTGTCTGCCACTGTCAGCCATTTGGGGATATTAAGGTTGTTGAATCCATTCTGGTAGT
 
. : . : . : . : . : . :
rJMSF023P20+ TATGCAGAAAAGACAACTGGTTCATGTATGAGCCCAGCTGGATACCAGGCTGCAATGTAA
                      ____________________________________________________________
consensus TATGCAGAAAAGACAACTGGTTCATGTATGAGCCCAGCTGGATACCAGGCTGCAATGTAA
 
. : . : . : . : . : . :
rJMSF023P20+ GCATTCACTCTCGTCTTTAAGCTTTACATACTTTCTGTTCCTCGATGTAAAACAACTATA
                      ____________________________________________________________
consensus GCATTCACTCTCGTCTTTAAGCTTTACATACTTTCTGTTCCTCGATGTAAAACAACTATA