Previous Contig 012328:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFS135G09Sequence649012328 (3)gb:AP005592_18546305e-15Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 9, PAC clone:P063
JMSF023O07Sequence539006181 (3)gb:AY063883_15658313e-10Arabidopsis thaliana unknown protein (At3g13222) mRNA, complete cds.>gb:AY142588320012328 (3)
JMSF036F24Sequence190006181 (3)320012328 (3)

Alignment

This contig is upended


. : . : . : . : . : . :
JMFS135G09- GAGGGGCAACTGGAAGGGATTTATCAATGTTACCTCAGGCCAATTACTTTTAC
                      ____________________________________________________________
consensus GAGGGGCAACTGGAAGGGATTTATCAATGTTACCTCAGGCCAATTACTTTTAC
 
. : . : . : . : . : . :
JMFS135G09- AACTTACCTCAGGCCCAGATGAATGAAAAGAATATCTACTCCACACTAAAACAGAATGAA
                      ____________________________________________________________
consensus AACTTACCTCAGGCCCAGATGAATGAAAAGAATATCTACTCCACACTAAAACAGAATGAA
 
. : . : . : . : . : . :
JMFS135G09- GAGCCACATGTTTGGACCTCGGCAACTGGAAGGGATTTATCAATGTTACCTCAGGCCAAT
                      ____________________________________________________________
consensus GAGCCACATGTTTGGACCTCGGCAACTGGAAGGGATTTATCAATGTTACCTCAGGCCAAT
 
. : . : . : . : . : . :
JMFS135G09- TACTTTTACAACTTACCTCAGGCCCAGCAAATGGCTTTCCCCCCTGGACATTCTACACAT
                      ____________________________________________________________
consensus TACTTTTACAACTTACCTCAGGCCCAGCAAATGGCTTTCCCCCCTGGACATTCTACACAT
 
. : . : . : . : . : . :
JMFS135G09- GGATCTTTTCCCGGTATCTATCATCCATCCCAGTCGGTTGCTACCCCATCAAACATTCAA
                      ____________________________________________________________
consensus GGATCTTTTCCCGGTATCTATCATCCATCCCAGTCGGTTGCTACCCCATCAAACATTCAA
 
. : . : . : . : . : . :
JMFS135G09- TCATTACCCCAGCAAACTCAGGCTGTTGGTGGATCAGTTGATGCACTTCCTCCTTCCGGT
                      ____________________________________________________________
consensus TCATTACCCCAGCAAACTCAGGCTGTTGGTGGATCAGTTGATGCACTTCCTCCTTCCGGT
 
. : . : . : . : . : . :
JMFS135G09- GCTCATCAGCAATTGCAACCTCAAATGAATTGGAATTCAACATTTTTGAATAGGGAAAAT
                      ____________________________________________________________
consensus GCTCATCAGCAATTGCAACCTCAAATGAATTGGAATTCAACATTTTTGAATAGGGAAAAT
 
. : . : . : . : . : . :
JMFS135G09- ATCTGAGGATAAAATCCATCGAGGATAAGTGTGTGCGTGCATATATGCACCATACAAAAA
rJMSF036F24+ AAAA
rJMSF023O07+ AAAA
                      ____________________________________________________________
consensus ATCTGAGGATAAAATCCATCGAGGATAAGTGTGTGCGTGCATATATGCACCATACAAAAA
 
. : . : . : . : . : . :
JMFS135G09- AACTAAAAAAAAAAAAAAAACTAAAATAACATGCAACCCCGAGCTCTGTATGACTGTAAA
rJMSF036F24+ AACTTAAAAAAAAAAAAAAACTAAAATAACATGCAACCCCGAGCTCTGTATGACTGTAAA
rJMSF023O07+ AACTNAAAAAAAAAAAAAAACTAAAATAACATGCAACCCCGAGCTCTGTATGACTGTAAA
                      ____________________________________________________________
consensus AACTTAAAAAAAAAAAAAAACTAAAATAACATGCAACCCCGAGCTCTGTATGACTGTAAA
 
. : . : . : . : . : . :
JMFS135G09- TATGAAGTATACTTTTGAAATGTAGGCAATTTTGGGTGTTTTGCCCGGAATTTACACCCT
rJMSF036F24+ TATGAAGTATACTTTTGAAATGTAGGCAATTTTGGGTGTTTTGCCCGGAATTTACACCCT
rJMSF023O07+ TATGAAGTATACTTTTGAAATGTAGGCAATTTTGGGTGTTTTGCCCGGAATTTACACCCT
                      ____________________________________________________________
consensus TATGAAGTATACTTTTGAAATGTAGGCAATTTTGGGTGTTTTGCCCGGAATTTACACCCT
 
. : . : . : . : . : . :
JMFS135G09- GTCGTGTTTTGATGCACAGTTTTACCCATCTGCAGATGATAAC-AATAGTCTTCGAT
rJMSF036F24+ GTCGTGTTTTGATGCACAGTTTTACCCATCTGCAGATGATAACAAATAGTCTTCGATTTC
rJMSF023O07+ GTCGTGTTTTGATGCACAGTTTTACCCATCTGCAGATGATAACAAATAGTCTTCGATTTC
                      ____________________________________________________________
consensus GTCGTGTTTTGATGCACAGTTTTACCCATCTGCAGATGATAACAAATAGTCTTCGATTTC
 
. : . : . : . : . : . :
rJMSF036F24+ TTCTTTTATTTTAGCTAATAGGTGTTTGGAAGTTTGATAGAGCAGGTGGAATAATTTTCT
rJMSF023O07+ TTCTTTTATTTTAGCTAATAGGTGTTTGGAAGTTTGATAGAGCAGGTGGAATAATTTTCT
                      ____________________________________________________________
consensus TTCTTTTATTTTAGCTAATAGGTGTTTGGAAGTTTGATAGAGCAGGTGGAATAATTTTCT
 
. : . : . : . : . : . :
rJMSF036F24+ GATTGTCATTCTCATTTTCACCTGTATATATTTGAGAACCAAAATGTGGATT
rJMSF023O07+ GATTGTCATTCTCATTTTCACCTGTATATATTTGAGAA-CAAAATGTGGATTTATACTCT
                      ____________________________________________________________
consensus GATTGTCATTCTCATTTTCACCTGTATATATTTGAGAACCAAAATGTGGATTTATACTCT