Previous Contig 012320:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMSF010L09Sequence479012320 (3)gb:AP002092_18219953e-59Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, PAC clone:P003772012320 (3)gb:AP002092_18219952e-81Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, PAC clone:P003
JMSF023M03Sequence660019313gb:AP002092_18219953e-85Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, PAC clone:P003679012320 (3)gb:AP002092_18219954e-28Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, PAC clone:P003

Alignment

This contig is upended


. : . : . : . : . : . :
JMSF010L09- GTTTTGTTCTACTTTACTTAAG
                      ____________________________________________________________
consensus GTTTTGTTCTACTTTACTTAAG
 
. : . : . : . : . : . :
JMSF010L09- ATTTCAGACATTGAGAATTTAATAGTGGCCCCCATATCCAAGGCTTCAGCTCGACAAAGG
                      ____________________________________________________________
consensus ATTTCAGACATTGAGAATTTAATAGTGGCCCCCATATCCAAGGCTTCAGCTCGACAAAGG
 
. : . : . : . : . : . :
JMSF010L09- GCTGGTAGAGCTGGAAGAGTTCGACCTGGAAAATGTTTCAGGCTCTATACTGAAGAATAT
                      ____________________________________________________________
consensus GCTGGTAGAGCTGGAAGAGTTCGACCTGGAAAATGTTTCAGGCTCTATACTGAAGAATAT
 
. : . : . : . : . : . :
JMSF010L09- TTCTTAAATGAGATGTCTACCCAGGGAATTCCTGAGATACAGAGATCAAGCCTTGTTTCA
                      ____________________________________________________________
consensus TTCTTAAATGAGATGTCTACCCAGGGAATTCCTGAGATACAGAGATCAAGCCTTGTTTCA
 
. : . : . : . : . : . :
JMSF010L09- TGTGTTATTCAGTTAAAGGCCTTGGGCATTGACAATATATTAGGGTTTGATTGGCCTGCA
                      ____________________________________________________________
consensus TGTGTTATTCAGTTAAAGGCCTTGGGCATTGACAATATATTAGGGTTTGATTGGCCTGCA
 
. : . : . : . : . : . :
JMSF010L09- TCTCCATCACCTGAAGCAATGATTAGAGCACTTGAGATATTGTACTCACTTGGAGTACTT
                      ____________________________________________________________
consensus TCTCCATCACCTGAAGCAATGATTAGAGCACTTGAGATATTGTACTCACTTGGAGTACTT
 
. : . : . : . : . : . :
JMSF010L09- GATGATGATGCTAAACTCACTTCACCTGCTGGATTTCAAGTTGCTGAGATTCCATTAGAC
                      ____________________________________________________________
consensus GATGATGATGCTAAACTCACTTCACCTGCTGGATTTCAAGTTGCTGAGATTCCATTAGAC
 
. : . : . : . : . : . :
JMSF010L09- CCAATGATCTCGAAGATGATCTTGGCTTCAAGTGAATCTGGATGTTCTGAGGAAATTATT
rJMSF010L09+ GAAGATGATC-TGGCNTCAAGNGAATCNGGATGTTCTGAGGAAATTATT
                      ____________________________________________________________
consensus CCAATGATCTCGAAGATGATCTTGGCTTCAAGTGAATCTGGATGTTCTGAGGAAATTATT
 
. : . : . : . : . : . :
JMSF010L09- ACCATTGCTGCGGTTCTCTCAATACAGTCCATCTGGA
rJMSF010L09+ ACCATTGCTGCGGTTCTCTCAATACAGTCCATCTGGATTTCCCTGAGGGGAGTACAAAAG
                      ____________________________________________________________
consensus ACCATTGCTGCGGTTCTCTCAATACAGTCCATCTGGATTTCCCTGAGGGGAGTACAAAAG
 
. : . : . : . : . : . :
rJMSF010L09+ GAAATGGATGAAGCGAAGTTGAGATTTGCTGCAGCTGAGGGTGATCATGTCACTTTCTTA
                      ____________________________________________________________
consensus GAAATGGATGAAGCGAAGTTGAGATTTGCTGCAGCTGAGGGTGATCATGTCACTTTCTTA
 
. : . : . : . : . : . :
rJMSF010L09+ AATGTGTACAAAGGATTCATTCAGTCAAATAAATCTTCAAAGTGGTGTCAGAAGAATTTT
                      ____________________________________________________________
consensus AATGTGTACAAAGGATTCATTCAGTCAAATAAATCTTCAAAGTGGTGTCAGAAGAATTTT
 
. : . : . : . : . : . :
rJMSF010L09+ ATTAACTATCATGCCATGAAAAAGGTTATGGAAGTTAGGGAACAACTAAGAAGGATTGTG
                      ____________________________________________________________
consensus ATTAACTATCATGCCATGAAAAAGGTTATGGAAGTTAGGGAACAACTAAGAAGGATTGTG
 
. : . : . : . : . : . :
rJMSF010L09+ CTGCGCTTGGGCTTAAGTCTGAAATCTTGTGAAGGGGACATGCAGGCAGTAAGGAAAGCA
                      ____________________________________________________________
consensus CTGCGCTTGGGCTTAAGTCTGAAATCTTGTGAAGGGGACATGCAGGCAGTAAGGAAAGCA
 
. : . : . : . : . : . :
rJMSF010L09+ ATTACAATGGGATTTTTTGCTAATGCTTGTCGTTTAGAAGCATTCAGCCACAATGGCATG
rJMSF023M03+ ATTCAGCCACAATGGCATG
                      ____________________________________________________________
consensus ATTACAATGGGATTTTTTGCTAATGCTTGTCGTTTAGAAGCATTCAGCCACAATGGCATG
 
. : . : . : . : . : . :
rJMSF010L09+ TACAAGACTGTCAGAGGTTCTCAAGAAGTTTATATTCATCCTTCATCTATTTTATTCAGG
rJMSF023M03+ TACAAGACTGTCAGAGGTTCTCAAGAAGTTTATATTCATCCTTCATCTATCTTATTCAGG
                      ____________________________________________________________
consensus TACAAGACTGTCAGAGGTTCTCAAGAAGTTTATATTCATCCTTCATCTATTTTATTCAGG
 
. : . : . : . : . : . :
rJMSF010L09+ GTCAACCCGAAGTGGGTGATATACCAATCTCTTGTTTCAACTGATCGTCAGTACATGCGC
rJMSF023M03+ GTCAACCCGAAGTGGGTGATATACCAATCTCTTGTTTCAACTGATCGTCAGTACATGCGC
                      ____________________________________________________________
consensus GTCAACCCGAAGTGGGTGATATACCAATCTCTTGTTTCAACTGATCGTCAGTACATGCGC
 
. : . : . : . : . : . :
rJMSF010L09+ AATGTCATTTCCATAGATCCTTCTTGGTTGCGAGAGGCAGCTCCGCACTTCTACCAACCT
rJMSF023M03+ AATGTCATTTCCATAGATCCTTCTTGGTTGCGAGAGGCAGCTCCGCACTTCTACCAACCT
                      ____________________________________________________________
consensus AATGTCATTTCCATAGATCCTTCTTGGTTGCGAGAGGCAGCTCCGCACTTCTACCAACCT
 
. : . : . : . : . : . :
rJMSF010L09+ CAACACCCCAATTCTATCCCTCGCTGATTCGTCTCCTCTTTCTTACTCCCAGAAAGTTAG
rJMSF023M03+ CAACACCCCAATTCTATCCCTCGTTGATTCGTCTCCTCTTTCTTACTCCCAGAAAGTTAG
                      ____________________________________________________________
consensus CAACACCCCAATTCTATCCCTCGTTGATTCGTCTCCTCTTTCTTACTCCCAGAAAGTTAG
 
. : . : . : . : . : . :
rJMSF010L09+ CCTGATATTGTATATGCATTAGCTGAG
rJMSF023M03+ CCTGATATTGTATATGCATTAGCTGAGTTCATGGATGGTCATTGGAATGTCTCTGCCTGA
                      ____________________________________________________________
consensus CCTGATATTGTATATGCATTAGCTGAGTTCATGGATGGTCATTGGAATGTCTCTGCCTGA
 
. : . : . : . : . : . :
rJMSF023M03+ GCCTTGAAGTAGATATAGTATTCACTTTGAGTGATGAGGAGAACCCGCAGCCACTATTTG
                      ____________________________________________________________
consensus GCCTTGAAGTAGATATAGTATTCACTTTGAGTGATGAGGAGAACCCGCAGCCACTATTTG
 
. : . : . : . : . : . :
rJMSF023M03+ AGGATGTACACCGAGTAAACTCACATTTTGACCTTAGTTGACAAAGGATCACAATGAGGT
                      ____________________________________________________________
consensus AGGATGTACACCGAGTAAACTCACATTTTGACCTTAGTTGACAAAGGATCACAATGAGGT
 
. : . : . : . : . : . :
rJMSF023M03+ AAATCAGCTTAGGTTGTCTATAGCCGCGATCTGCTCAAACCAAGAATGCTAATAGACCAC
                      ____________________________________________________________
consensus AAATCAGCTTAGGTTGTCTATAGCCGCGATCTGCTCAAACCAAGAATGCTAATAGACCAC
 
. : . : . : . : . : . :
rJMSF023M03+ TCTTGTTGAGAGTTAAACTTGTAACCTTGTGATTATTAAGTCAACAACTTAATCAACTTG
                      ____________________________________________________________
consensus TCTTGTTGAGAGTTAAACTTGTAACCTTGTGATTATTAAGTCAACAACTTAATCAACTTG
 
. : . : . : . : . : . :
rJMSF023M03+ GTCAGGGTTGTCCCCTATAATTTTCACCTTTTAGTTCTTGGTACTTGGTAGAAGTTTTGG
                      ____________________________________________________________
consensus GTCAGGGTTGTCCCCTATAATTTTCACCTTTTAGTTCTTGGTACTTGGTAGAAGTTTTGG
 
. : . : . : . : . : . :
rJMSF023M03+ GTCCATTTTGTAGGTTTCTTTTTTTGGTACAAAATCATGTACTTATAAATTATTGATATC
                      ____________________________________________________________
consensus GTCCATTTTGTAGGTTTCTTTTTTTGGTACAAAATCATGTACTTATAAATTATTGATATC