Previous Contig 012316:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF046D20Sequence399012316 (6)454012316 (6)gb:AC091627_17348307e-31Solanum demissum chromosome 11 BAC PGEC513 genomic sequence, complete sequence.
JMSF023J17Sequence671012316 (6)pir|G96724|G967241e-23hypothetical protein F20P5.9 [imported] - Arabidopsis thaliana>gb:AE005173_89460729012316 (6)pir|G96724|G967245e-48hypothetical protein F20P5.9 [imported] - Arabidopsis thaliana>gb:AE005173_89460
JMSF038M06Sequence668012316 (6)pir|G96724|G967242e-22hypothetical protein F20P5.9 [imported] - Arabidopsis thaliana>gb:AE005173_89460822012316 (6)pir|G96724|G967246e-48hypothetical protein F20P5.9 [imported] - Arabidopsis thaliana>gb:AE005173_89460

Alignment

This contig is upended


. : . : . : . : . : . :
JMSF038M06- GGCTTCCTTCTTCTTCTCCAGACGGCG
JMFF046D20- GGCTTCCTTCTTCTTCTCCAGACGACG
JMSF023J17- GCTCGGCTTCCTTCTTCTTCTCCAGACGACG
                      ____________________________________________________________
consensus GCTCGGCTTCCTTCTTCTTCTCCAGACGACG
 
. : . : . : . : . : . :
JMSF038M06- GTTCTCCCTCGTCTCCGGTCTCTGCGTTTCACGCCCTCCGCCCTGGGCGACACTCCTCTG
JMFF046D20- GTTCTCCCTCGTCTCCGGTCTCTGCGTTTCACGCCCTCCGCCCTGGGCGACACTCCTCTG
JMSF023J17- GTTCTCCCTCGTCTCCGGTCTCTGCGTTTCACGCCCTCCGCCCTGGGCGACACTCCTCTG
                      ____________________________________________________________
consensus GTTCTCCCTCGTCTCCGGTCTCTGCGTTTCACGCCCTCCGCCCTGGGCGACACTCCTCTG
 
. : . : . : . : . : . :
JMSF038M06- GTCAGGCGATCACGCCCTCCGGCCTCCGGCCTCCGCCCTCGCTCCTCAGTCAGACGGTCA
JMFF046D20- GTCAGGCGATCACGCCCTCCGGCCTCCGGCCTCCGCCCTCGCTCCTCAGTCAGACGGTCA
JMSF023J17- GTCAGGCGATCACGCCCTCCGGCCTCCGGCCTCCGCCCTCGCTCCTCAGTCAGACGGTCA
                      ____________________________________________________________
consensus GTCAGGCGATCACGCCCTCCGGCCTCCGGCCTCCGCCCTCGCTCCTCAGTCAGACGGTCA
 
. : . : . : . : . : . :
JMSF038M06- GACACTCAGACTCACTCCATCGACTCAGGCACTTAGCGGCTCTGCCTCACTGAGACACTG
JMFF046D20- GACACTCAGACTCACTCCATCGACTCAGGCACTTAGCGGCTCTGCCTCACTGAGACACTG
JMSF023J17- GACACTCAGACTCACTCCATCGACTCAGGCACTTAGCGGCTCTGCCTCACTGAGACACTG
rJMSF038M06+ ACTGAGACACTG
                      ____________________________________________________________
consensus GACACTCAGACTCACTCCATCGACTCAGGCACTTAGCGGCTCTGCCTCACTGAGACACTG
 
. : . : . : . : . : . :
JMSF038M06- GAAGGAGGTGATTTGCTGCATAAGAGAGCACCAAATAAATGGTTGTTTATTAGTCATCTA
JMFF046D20- GAAGGAGGTGATTTGCTGCATAAGAGAGCACCAAATAAATGGTTGTTTATTAGTCATCTA
JMSF023J17- GAAGGAGGTGATTTGCTGCATAAGAGAGCACCAAATAAATGGTTGTTTATTAGTCATCTA
rJMSF038M06+ GAAGGAGGTGATTTGCTGCATAAGAGAGCACCAAATAAATGGTTGTTTATTAGTCATCTA
                      ____________________________________________________________
consensus GAAGGAGGTGATTTGCTGCATAAGAGAGCACCAAATAAATGGTTGTTTATTAGTCATCTA
 
. : . : . : . : . : . :
JMSF038M06- CTGCATAGTATAATGGCTTTGATTACACGGTTAAGGCATCGTCTGCCTGGTCTACTCATA
JMFF046D20- CTGCATAGTATAATGGCTTTGATTACACGGTTAAGGCATCGTCTGCCTGGTCTACTCATA
JMSF023J17- CTGCATAGTATAATGGCTTTGATTACACGGTTAAGGCATCGTCTGCCTGGTCTACTCATA
rJMSF038M06+ CTGCATAGTATAATGGCTTTGATTACACGGTTAAGGCATCGTCTGCCTGGTCTACTCATA
rJMSF023J17+ CTACTCATA
                      ____________________________________________________________
consensus CTGCATAGTATAATGGCTTTGATTACACGGTTAAGGCATCGTCTGCCTGGTCTACTCATA
 
. : . : . : . : . : . :
JMSF038M06- AGACAACCTATTCTGTACAATGTGACTGTACGATTTCCAGTTACCTCAGCTGGTTGCACT
JMFF046D20- AGACAACCTATTCTGTACAATGTGACTGTACGATTTCCAGTTACCTCAGCTGGTTGCACT
JMSF023J17- AGACAACCTATTCTGTACAATGTGACTGTACGATTTCCAGTTACCTCAGCTGGTTGCACT
rJMSF038M06+ AGACAACCTATTCTGTACAATGTGACTGTACGATTTCCAGTTACCTCAGCTGGTTGCACT
rJMSF023J17+ AGACAACCTATTCTGTACAATGTGACTGTACGATTTCCAGTTACCTCAGCTGGTTGCACT
                      ____________________________________________________________
consensus AGACAACCTATTCTGTACAATGTGACTGTACGATTTCCAGTTACCTCAGCTGGTTGCACT
 
. : . : . : . : . : . :
JMSF038M06- CGACACATTGCTCAACCTGCCAGGAAAGAGGAAGAAGAGGAGGAAGAAGTAGAGATTGAT
JMFF046D20- CGACACATTGC
JMSF023J17- CGACACATTGCTCAACCTGCCAGGAAAGAGGAAGAAGAGGAGGAAGAAGTAGAGATTGAT
rJMSF038M06+ CGACACATTGCTCAACCTGCCAGGAAAGAGGAAGAAGAGGAGGAAGAAGTAGAGATTGAT
rJMSF023J17+ CGACACATTGCTCAACCTGCCAGGAAAGAGGAAGAAGAGGAGGAAGAAGTAGAGATTGAT
                      ____________________________________________________________
consensus CGACACATTGCTCAACCTGCCAGGAAAGAGGAAGAAGAGGAGGAAGAAGTAGAGATTGAT
 
. : . : . : . : . : . :
JMSF038M06- CAGAGAAGACTTCCAGCTGATTATGACCCTGCAACGTTTGATCCAACCGAGCATCGCAGT
JMSF023J17- CAGAGAAGACTTCCAGCTGATTATGACCCTGCAACGTTTGATCCAACCGAGCATCGCAGT
rJMSF038M06+ CAGAGAAGACTTCCAGCTGATTATGACCCTGCAACGTTTGATCCAACCGAGCATCGCAGT
rJMSF023J17+ CAGAGAAGACTTCCAGCTGATTATGACCCTGCAACGTTTGATCCAACCGAGCATCGCAGT
                      ____________________________________________________________
consensus CAGAGAAGACTTCCAGCTGATTATGACCCTGCAACGTTTGATCCAACCGAGCATCGCAGT
 
. : . : . : . : . : . :
JMSF038M06- CCTCCAACGGACAGAGTGTGGAGGCTTGTTGATGAAGTTTCGGGACTTACATTGGTTGAA
JMSF023J17- CCTCCAACGGACAGAGTGTGGAGGCTTGTTGATGAAGTTTCGGGACTTACATTGGTTGAA
rJMSF038M06+ CCTCCAACGGACAGAGTGTGGAGGCTTGTTGATGAAGTTTCGGGACTTACATTGGTTGAA
rJMFF046D20+ AA
rJMSF023J17+ CCTCCAACGGACAGAGTGTGGAGGCTTGTTGATGAAGTTTCGGGACTTACATTGGTTGAA
                      ____________________________________________________________
consensus CCTCCAACGGACAGAGTGTGGAGGCTTGTTGATGAAGTTTCGGGACTTACATTGGTTGAA
 
. : . : . : . : . : . :
JMSF038M06- GTTGCAGAGCTGTCTGGCATTTTGATGAAGAAGTTGGGAATGACAGAACCACCTGTAGTG
JMSF023J17- GTTGCAGAGCTGTCTGGCATTTTGATGAAGAAGTTGGGAATGACAGAACCACCTGTAGTG
rJMSF038M06+ GTTGCAGAGCTGTCTGGCATTTTGATGAAGAAGTTGGGAATGACAGAACCACCTGTAGTG
rJMFF046D20+ GTTGCAGAGCTGTCTGGCATTTTGATGAAGAAGTTGGGAATGACAGAACCACCTGTAGTG
rJMSF023J17+ GTTGCAGAGCTGTCTGGCATTTTGATGAAGAAGTTGGGAATGACAGAACCACCTGTAGTG
                      ____________________________________________________________
consensus GTTGCAGAGCTGTCTGGCATTTTGATGAAGAAGTTGGGAATGACAGAACCACCTGTAGTG
 
. : . : . : . : . : . :
JMSF038M06- GGGATTATGAAGGCGGGTGCAGCTGGCATGGCTGCAGC
JMSF023J17- GGGATTATGAAGGCGGGTGCAGCTGGCATGGCTGCAGCTA
rJMSF038M06+ GGGATTATGAAGGCGGGTGCAGCTGGCATGGCTGCAGCTACAATGAAGGGACCGGCAGCA
rJMFF046D20+ GGGATTATGAAGGCGGGTGCAGCTGGCATGGCTGCAGCTACAATGAAGGGACCGGCAGCA
rJMSF023J17+ GGGATTATGAAGGCGGGTGCAGCTGGCATGGCTGCAGCTACAATGAAGGGACCGGCAGCA
                      ____________________________________________________________
consensus GGGATTATGAAGGCGGGTGCAGCTGGCATGGCTGCAGCTACAATGAAGGGACCGGCAGCA
 
. : . : . : . : . : . :
rJMSF038M06+ GCTAAGGAGGAAAAGAAACCTGAGAAGACTGTTTTTGAGCTGAAGATAGAGTCTTTTGAT
rJMFF046D20+ GCTAAGGAGGAAAAGAAACCTGAGAAGACTGTTTTTGAGCTGAAGATAGAGTCTTTTGAT
rJMSF023J17+ GCTAAGGAGGAAAAGAAACCTGAGAAGACTGTTTTTGAGCTGAAGATAGAGTCTTTTGAT
                      ____________________________________________________________
consensus GCTAAGGAGGAAAAGAAACCTGAGAAGACTGTTTTTGAGCTGAAGATAGAGTCTTTTGAT
 
. : . : . : . : . : . :
rJMSF038M06+ GCTGCTCAAAAGATAAAGATAATTAAAGAGATCCGCAGTGTTACTGATTTAGGTCTCAAG
rJMFF046D20+ GCTGCTCAAAAGATAAAGATAATTAAAGAGATCCGCAGTGTTACTGATTTAGGTCTCAAG
rJMSF023J17+ GCTGCTCAAAAGATAAAGATAATTAAAGAGATCCGCAGTGTTACTGATTTAGGTCTCAAG
                      ____________________________________________________________
consensus GCTGCTCAAAAGATAAAGATAATTAAAGAGATCCGCAGTGTTACTGATTTAGGTCTCAAG
 
. : . : . : . : . : . :
rJMSF038M06+ GAAGCAAAGGAATTAGTGGAGAAAGCGCCTGCAATATTCAAAAAGGGAGTTTCGAAGGAC
rJMFF046D20+ GAAGCAAAGGAATTAGTGGAGAAAGCGCCTGCAATATTCAAAAAGGGAGTTTCGAAGGAC
rJMSF023J17+ GAAGCAAAGGAATTAGTGGAGAAAGCGCCTGCAATATTCAAAAAGGGAGTTTCGAAGGAC
                      ____________________________________________________________
consensus GAAGCAAAGGAATTAGTGGAGAAAGCGCCTGCAATATTCAAAAAGGGAGTTTCGAAGGAC
 
. : . : . : . : . : . :
rJMSF038M06+ GAAGGAGAGCAAATCATTGGGAAGATGAAGGCGGTTGGGGCCAAAGTTGTTATGGAATGA
rJMFF046D20+ GAAGGAGAGCAAATCATTGAGAAGATGAAGGCGGTTGGGGCCAAAGTTGTTATGGAATGA
rJMSF023J17+ GAAGGAGAGCAAATCATTGAGAAGATGAAGGCGGTTGGGGCCAAAGTTGTTATGGAATGA
                      ____________________________________________________________
consensus GAAGGAGAGCAAATCATTGAGAAGATGAAGGCGGTTGGGGCCAAAGTTGTTATGGAATGA
 
. : . : . : . : . : . :
rJMSF038M06+ AACTGAACTTGCTTCTGTTCATCTATTGAATTTTCTGGAATCAATCAATGTTTCTCAGTT
rJMFF046D20+ AACTGAACTTGCTTCTGTTCATCTATTGAATTTTCTGGAATCAATCAATGTTTCTCAGTT
rJMSF023J17+ AACTGAACTTGCTTCTGTTCATCTATTGAATTTTCTGGAATCAATCAATGTTTCTCAGTT
                      ____________________________________________________________
consensus AACTGAACTTGCTTCTGTTCATCTATTGAATTTTCTGGAATCAATCAATGTTTCTCAGTT
 
. : . : . : . : . : . :
rJMSF038M06+ TTAGCTTCAA
rJMFF046D20+ TTAGCTTCAA
rJMSF023J17+ TTAGCTTCAATCTTCTTGCTTTATTTTTGCCTTATCAAGGATTTAGAAATAATTTCATAC
                      ____________________________________________________________
consensus TTAGCTTCAATCTTCTTGCTTTATTTTTGCCTTATCAAGGATTTAGAAATAATTTCATAC