Previous Contig 012312:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMSF023I05Sequence622012312 (2)gb:AY074586_15676242e-41Arabidopsis thaliana AT3g53630/F4P12_330 mRNA, complete cds.>gb:AY097380_1576375764012312 (2)gb:AY074586_15676241e-40Arabidopsis thaliana AT3g53630/F4P12_330 mRNA, complete cds.>gb:AY097380_1576375

Alignment

This contig is upended


. : . : . : . : . : . :
JMSF023I05- GAGTCTCAAGTCCCAATTTCCT
                      ____________________________________________________________
consensus GAGTCTCAAGTCCCAATTTCCT
 
. : . : . : . : . : . :
JMSF023I05- CTTTTTATTCTGGAAGCCCCAAAACCCCAAACCTCCTAAACCCCTGCAATCCCACCATCG
                      ____________________________________________________________
consensus CTTTTTATTCTGGAAGCCCCAAAACCCCAAACCTCCTAAACCCCTGCAATCCCACCATCG
 
. : . : . : . : . : . :
JMSF023I05- CTGTGGCCGACCGCCGACCGCCGACCGCCGACCGCCGACCGCCACCATGAATTCATCGTT
                      ____________________________________________________________
consensus CTGTGGCCGACCGCCGACCGCCGACCGCCGACCGCCGACCGCCACCATGAATTCATCGTT
 
. : . : . : . : . : . :
JMSF023I05- CAACACCACTCCTAATTTCGACAACCTCCTCCTCCAATCCCTAATGGGCAGACTCCAAAT
                      ____________________________________________________________
consensus CAACACCACTCCTAATTTCGACAACCTCCTCCTCCAATCCCTAATGGGCAGACTCCAAAT
 
. : . : . : . : . : . :
JMSF023I05- CCGCCCTTCACCGCCTCCAAACCCTGCTTTGCTCTCCGCCAAATCCCTCGAAGACCTCCT
                      ____________________________________________________________
consensus CCGCCCTTCACCGCCTCCAAACCCTGCTTTGCTCTCCGCCAAATCCCTCGAAGACCTCCT
 
. : . : . : . : . : . :
JMSF023I05- CCTCAACAACCTCCTCTCCGACCAAACAGACGACCCGGATGATGACGACGACGACGACGT
rJMSF023I05+ TCCGACCAAACAGACGACCCGGATGATGACGACGACGACGACGT
                      ____________________________________________________________
consensus CCTCAACAACCTCCTCTCCGACCAAACAGACGACCCGGATGATGACGACGACGACGACGT
 
. : . : . : . : . : . :
JMSF023I05- CGAACCCTCCTACAAATCCCAGCTCGCCAAAGAAGAATCCAAGCTCGAGAAGGAGATCAT
rJMSF023I05+ CGAACCCTCCTACAAATCCCAGCTCGCCAAAGAAGAATCCAAGCTCGAGAAGGAGATCAT
                      ____________________________________________________________
consensus CGAACCCTCCTACAAATCCCAGCTCGCCAAAGAAGAATCCAAGCTCGAGAAGGAGATCAT
 
. : . : . : . : . : . :
JMSF023I05- CCGCACAATCCACAGCGGCAACACCGACTCTCTCAAGCCCAATTCCGGCCAGGCCGTCAC
rJMSF023I05+ CCGCACAATCCACAGCGGCAACACCGACTCTCTCAAGCCCAATTCCGGCCAGGCCGTCAC
                      ____________________________________________________________
consensus CCGCACAATCCACAGCGGCAACACCGACTCTCTCAAGCCCAATTCCGGCCAGGCCGTCAC
 
. : . : . : . : . : . :
JMSF023I05- AATCGGCGAGCATCACATATGCGTAGGGTTTCACGAGGACGAGGACTCGGATTATCGGGT
rJMSF023I05+ AATCGGCGAGCATCACATATGCGTAGGGTTTCACGAGGACGAGGACTCGGATTATCGGGT
                      ____________________________________________________________
consensus AATCGGCGAGCATCACATATGCGTAGGGTTTCACGAGGACGAGGACTCGGATTATCGGGT
 
. : . : . : . : . : . :
JMSF023I05- CTGGGAGTGGCACGGCCATATCATTCTGTTTGACGATGAAAACGGGTACAATCCTGAGTA
rJMSF023I05+ CTGGGAGTGGCACGGCCATATCATTCTGTTTGACGATGAAAACGGGTACAATCCTGAGTA
                      ____________________________________________________________
consensus CTGGGAGTGGCACGGCCATATCATTCTGTTTGACGATGAAAACGGGTACAATCCTGAGTA
 
. : . : . : . : . : . :
JMSF023I05- CATATATGGGAATTATTTTGAGAGACTCACTGCTAAGCCGGCAATGAAGAAGAAGCAGAG
rJMSF023I05+ CATATATGGGAATTATTTTGAGAGACTCACTGCTAAGCCGGCAATGAAGAAGAAGCAGAG
                      ____________________________________________________________
consensus CATATATGGGAATTATTTTGAGAGACTCACTGCTAAGCCGGCAATGAAGAAGAAGCAGAG
 
. : . : . : . : . : . :
rJMSF023I05+ TGAAGAGAAGGAGGTGGAGAAGGTCGGGAATATGGGCTTGAAGGAGTTGATAGAGTCGGC
                      ____________________________________________________________
consensus TGAAGAGAAGGAGGTGGAGAAGGTCGGGAATATGGGCTTGAAGGAGTTGATAGAGTCGGC
 
. : . : . : . : . : . :
rJMSF023I05+ AGAGTCTAATTCTGAGGCTCGGATTCTTAGGAGGAATATCAATGCCGGATCTTCAAATTT
                      ____________________________________________________________
consensus AGAGTCTAATTCTGAGGCTCGGATTCTTAGGAGGAATATCAATGCCGGATCTTCAAATTT
 
. : . : . : . : . : . :
rJMSF023I05+ TAAATCAGGTTCTAGTTGAGAAGTTTGCCAAGTGCTCAGCAAGCGTTCTTGCTCTAAGCT
                      ____________________________________________________________
consensus TAAATCAGGTTCTAGTTGAGAAGTTTGCCAAGTGCTCAGCAAGCGTTCTTGCTCTAAGCT
 
. : . : . : . : . : . :
rJMSF023I05+ CACATTGAGGTTGCTCTTTTCCCCTCAGCTGCATGGTGAAGCGCCTTTTTGTTCAAATGG
                      ____________________________________________________________
consensus CACATTGAGGTTGCTCTTTTCCCCTCAGCTGCATGGTGAAGCGCCTTTTTGTTCAAATGG
 
. : . : . : . : . : . :
rJMSF023I05+ CATTTTCCATAATTTCTAATTGAATGGTAAGCAGAGTATTGGGTTGTTGTCATGGGCAGC
                      ____________________________________________________________
consensus CATTTTCCATAATTTCTAATTGAATGGTAAGCAGAGTATTGGGTTGTTGTCATGGGCAGC
 
. : . : . : . : . : . :
rJMSF023I05+ TGAAACTGCACTTTAGCAGGTGTTCTGTACAACTTGAAGCCAATGCTATGAACTTTCAAT
                      ____________________________________________________________
consensus TGAAACTGCACTTTAGCAGGTGTTCTGTACAACTTGAAGCCAATGCTATGAACTTTCAAT
 
. : . : . : . : . : . :
rJMSF023I05+ AAAGGTGTTATTTGATACAAACAATGTTACATGTCCAGGTGGTTTTATGCACATGTCATC
                      ____________________________________________________________
consensus AAAGGTGTTATTTGATACAAACAATGTTACATGTCCAGGTGGTTTTATGCACATGTCATC