Previous Contig 012311:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFN003C22Sequence629012311 (6)sp|Q9MT28|THRC_SOLTUe-113Threonine synthase, chloroplast precursor (EC 4.2.3.1) (TS).>gb:AX268392_1465061
JMSF019C05Sequence780012311 (6)sp|Q9MT28|THRC_SOLTU3e-99Threonine synthase, chloroplast precursor (EC 4.2.3.1) (TS).>gb:AX268392_1465061
JMSF023I04Sequence741012311 (6)sp|Q9MT28|THRC_SOLTU2e-84Threonine synthase, chloroplast precursor (EC 4.2.3.1) (TS).>gb:AX268392_1465061
JMSF031F20Sequence706012311 (6)sp|Q9MT28|THRC_SOLTU9e-84Threonine synthase, chloroplast precursor (EC 4.2.3.1) (TS).>gb:AX268392_1465061
JMSF031P22Sequence660012311 (6)sp|Q9MT28|THRC_SOLTU3e-81Threonine synthase, chloroplast precursor (EC 4.2.3.1) (TS).>gb:AX268392_1465061
JMSF046G05Sequence831012311 (6)sp|Q9MT28|THRC_SOLTUe-118Threonine synthase, chloroplast precursor (EC 4.2.3.1) (TS).>gb:AX268392_1465061

Alignment

This contig is upended


. : . : . : . : . : . :
JMFN003C22- CCTGTG
                      ____________________________________________________________
consensus CCTGTG
 
. : . : . : . : . : . :
JMFN003C22- GGTGAAACACTGCGGGATTAGCCACACCGGGAGCTTTAAAGATCTGGGCATGACGGTTTT
                      ____________________________________________________________
consensus GGTGAAACACTGCGGGATTAGCCACACCGGGAGCTTTAAAGATCTGGGCATGACGGTTTT
 
. : . : . : . : . : . :
JMFN003C22- GGTGAGCCAGGTGAACCGGCTGCGGAAAATGAAGAAACCGGTGGTCGGCGTGGGCTGCGC
                      ____________________________________________________________
consensus GGTGAGCCAGGTGAACCGGCTGCGGAAAATGAAGAAACCGGTGGTCGGCGTGGGCTGCGC
 
. : . : . : . : . : . :
JMFN003C22- TTCCACCGGCGACACCTCGGCGGCGCTATCGGCCTATTGCGCCTCCGCTGGGATCCCGTC
                      ____________________________________________________________
consensus TTCCACCGGCGACACCTCGGCGGCGCTATCGGCCTATTGCGCCTCCGCTGGGATCCCGTC
 
. : . : . : . : . : . :
JMFN003C22- CATCGTCTTCCTCCCCGCAAATCGGATATCCCTTGCCCAATTAGTCCAGCCTATCGCGAA
                      ____________________________________________________________
consensus CATCGTCTTCCTCCCCGCAAATCGGATATCCCTTGCCCAATTAGTCCAGCCTATCGCGAA
 
. : . : . : . : . : . :
JMFN003C22- TGGCGCATTCGTGTTAAGCATCGACACAGATTTCGACGGGTGTATGCAGATGATTCGCGA
rJMSF046G05+ TATGCAGATGATTCGCGA
                      ____________________________________________________________
consensus TGGCGCATTCGTGTTAAGCATCGACACAGATTTCGACGGGTGTATGCAGATGATTCGCGA
 
. : . : . : . : . : . :
JMFN003C22- AGTCACATCGGAATTGCCCATTTACTTAGCCAATTCCCTCAACAGTTTGAGACTCGAGGG
rJMSF046G05+ AGTCACATCGGAATTGCCCATTTACTTAGCCAATTCCCTCAACAGTTTGAGACTCGAGGG
                      ____________________________________________________________
consensus AGTCACATCGGAATTGCCCATTTACTTAGCCAATTCCCTCAACAGTTTGAGACTCGAGGG
 
. : . : . : . : . : . :
JMFN003C22- CCAGAAAACGGCGGCCATTGAGATTTTGCAGCAATTCGATTGGCAAGTCCCAGATTGGGT
rJMSF046G05+ CCAGAAAACGGCGGCCATTGAGATTTTGCAGCAATTCGATTGGCAAGTCCCAGATTGGGT
rJMSF019C05+ TGCAGCNATTCGATTGGCAAGTCCCAGATTGGGT
                      ____________________________________________________________
consensus CCAGAAAACGGCGGCCATTGAGATTTTGCAGCAATTCGATTGGCAAGTCCCAGATTGGGT
 
. : . : . : . : . : . :
JMFN003C22- GATAGTTCCAGGTGGAAACTTAGGGAATATTTACGCATTCTACAAAGGGTTTCACATGTG
rJMSF046G05+ GATAGTTCCAGGTGGAAACTTAGGGAATATTTACGCATTCTACAAAGGGTTTCACATGTG
rJMSF031P22+ TG
rJMSF019C05+ GATAGTTCCAGGTGGAAACTTAGGGAATATTTACGCATTCTACAAAGGGTTTCACATGTG
rJMSF031F20+ ACAAAGGGTTTCACATGTG
rJMSF023I04+ CTACAAAGGGTTTCACATGTG
                      ____________________________________________________________
consensus GATAGTTCCAGGTGGAAACTTAGGGAATATTTACGCATTCTACAAAGGGTTTCACATGTG
 
. : . : . : . : . : . :
JMFN003C22- CAAAGAATTAGGGCTTGTTGACAGGATTCCCAGGCTGGTTTGTGCTCAAGCCGCCAATGC
rJMSF046G05+ CAAAGAATTAGGGCTTGTTGACAGGATTCCCAGGCTGGTTTGTGCTCAAGCCGCCAATGC
rJMSF031P22+ CAAAGAATTAGGNCTTGTTGACAGGATTCCCAGGCTGGTTTGTGCTCAAGCCGCCAATGC
rJMSF019C05+ CAAAGAATTAGGGCTTGTTGACAGGATTCCCAGGCTGGTTTGTGCTCAAGCCGCCAATGC
rJMSF031F20+ CAAAGAATTAGGGCTTGTTGACAGGATTCCCAGGCTGGTTTGTGCTCAAGCCGCCAATGC
rJMSF023I04+ CAAAGAATTAGGGCTTGTTGACAGGATTCCCAGGCTGGTTTGTGCTCAAGCCGCCAATGC
                      ____________________________________________________________
consensus CAAAGAATTAGGGCTTGTTGACAGGATTCCCAGGCTGGTTTGTGCTCAAGCCGCCAATGC
 
. : . : . : . : . : . :
JMFN003C22- TAATCCTCTTTACTTGCATTACAAATCCGGGTGGAAAGACTTCAAGCCCGTCAAAGCAAG
rJMSF046G05+ TAATCCTCTTTACTTGCATTACAAATCCGGGTGGAAAGACTTCAAGCCCGTCAAAGCAAG
rJMSF031P22+ TAATCCTCTTTACTTGCATTACAAATCCGGGTGGAAAGACTTCAAGCCCGTCAAAGCAAG
rJMSF019C05+ TAATCCTCTTTACTTGCATTACAAATCCGGGTGGAAAGACTTCAAGCCCGTCAAAGCAAG
rJMSF031F20+ TAATCCTCTTTACTTGCATTACAAATCCGGGTGGAAAGACTTCAAGCCCGTCAAAGCAAG
rJMSF023I04+ TAATCCTCTTTACTTGCATTACAAATCCGGGTGGAAAGACTTCAAGCCCGTCAAAGCAAG
                      ____________________________________________________________
consensus TAATCCTCTTTACTTGCATTACAAATCCGGGTGGAAAGACTTCAAGCCCGTCAAAGCAAG
 
. : . : . : . : . : . :
JMFN003C22- TTCCACTTTTGCATCCGCCATTC
rJMSF046G05+ TTCCACTTTTGCATCCGCCATTCAGATTGGTGACCCTGTATCTATAGATAGAGCTGTTTT
rJMSF031P22+ TTCCACTTTTGCATCCGCCATTCAGATTGGTGACCCTGTATCTATAGATAGAGCTGTTTT
rJMSF019C05+ TTCCACTTTTGCATCCGCCATTCAGATTGGTGACCCTGTATCTATAGATAGAGCTGTTTT
rJMSF031F20+ TTCCACTTTTGCATCCGCCATTCAGATTGGTGACCCTGTATCTATAGATAGAGCTGTTTT
rJMSF023I04+ TTCCACTTTTGCATCCGCCATTCAGATTGGTGACCCTGTATCTATAGATAGAGCTGTTTT
                      ____________________________________________________________
consensus TTCCACTTTTGCATCCGCCATTCAGATTGGTGACCCTGTATCTATAGATAGAGCTGTTTT
 
. : . : . : . : . : . :
rJMSF046G05+ TGCTCTCAAGAACTCAAATGGCATTGTCGAGGAGGCCACCGAGGAAGAATTGATGGATGC
rJMSF031P22+ TGCTCTCAAGAACTCAAATGGCATTGTCGAGGAGGCCACCGAGGAAGAATTGATGGATGC
rJMSF019C05+ TGCTCTCAAGAACTCAAATGGCATTGTCGAGGAGGCCACCGAGGAAGAATTGATGGATGC
rJMSF031F20+ TGCTCTCAAGAACTCAAATGGCATTGTCGAGGAGGCCACCGAGGAAGAATTGATGGATGC
rJMSF023I04+ TGCTCTCAAGAACTCAAATGGCATTGTCGAGGAGGCCACCGAGGAAGAATTGATGGATGC
                      ____________________________________________________________
consensus TGCTCTCAAGAACTCAAATGGCATTGTCGAGGAGGCCACCGAGGAAGAATTGATGGATGC
 
. : . : . : . : . : . :
rJMSF046G05+ CACGGCCCAGGCAGACTCAACCGGGATGTTCATATGCCCTCACACCGGGGTGGCATTGAC
rJMSF031P22+ CACGGCCCAGGCAGACTCAACCGGGATGTTCATATGCCCTCACACCGGGGTGGCATTGAC
rJMSF019C05+ CACGGCCCAGGCAGACTCAACCGGGATGTTCATATGCCCTCACACCGGGGTGGCATTGAC
rJMSF031F20+ CACGGCCCAGGCAGACTCAACCGGGATGTTCATATGCCCTCACACCGGGGTGGCATTGAC
rJMSF023I04+ CACGGCCCAGGCAGACTCAACCGGGATGTTCATATGCCCTCACACCGGGGTGGCATTGAC
                      ____________________________________________________________
consensus CACGGCCCAGGCAGACTCAACCGGGATGTTCATATGCCCTCACACCGGGGTGGCATTGAC
 
. : . : . : . : . : . :
rJMSF046G05+ TGCTCTAATCAAGTTAAGGAACAAAGGGGTGATCGGAGCAACGGATAGGACTGTTGTGGT
rJMSF031P22+ TGCTCTAATCAAGTTAAGGAACAAAGGGGTGATCGGAGCAACGGATAGGACTGTTGTGGT
rJMSF019C05+ TGCTCTAATCAAGTTAAGGAACAAAGGGGTGATCGGAGCAACGGATAGGACTGTTGTGGT
rJMSF031F20+ TGCTCTAATCAAGTTAAGGAACAAAGGGGTGATCGGAGCAACGGATAGGACTGTTGTGGT
rJMSF023I04+ TGCTCTAATCAAGTTAAGGAACAAAGGGGTGATCGGAGCAACGGATAGGACTGTTGTGGT
                      ____________________________________________________________
consensus TGCTCTAATCAAGTTAAGGAACAAAGGGGTGATCGGAGCAACGGATAGGACTGTTGTGGT
 
. : . : . : . : . : . :
rJMSF046G05+ TAGCACAGCTCATGGGCTCAAGTTTACTCAGTCCAAGATTGATTATCATTCGCAGGACAT
rJMSF031P22+ TAGCACAGCTCATGGGCTCAAGTTTACTCAGTCCAAGATTGATTATCATTCGCAGGACAT
rJMSF019C05+ TAGCACAGCTCATGGGCTCAAGTTTACTCAGTCCAAGATTGATTATCATTCGCAGGACAT
rJMSF031F20+ TAGCACAGCTCATGGGCTCAAGTTTACTCAGTCCAAGATTGATTATCATTCGCAGGACAT
rJMSF023I04+ TAGCACAGCTCATGGGCTCAAGTTTACTCAGTCCAAGATTGATTATCATTCGCAGGACAT
                      ____________________________________________________________
consensus TAGCACAGCTCATGGGCTCAAGTTTACTCAGTCCAAGATTGATTATCATTCGCAGGACAT
 
. : . : . : . : . : . :
rJMSF046G05+ AAAGGACATGGCTTGCCGCTTTGCAAACCCGCCTGTGCAGGTGAAAGCGGATTTTGGTTC
rJMSF031P22+ AAAGGACATGGCTTGCCGCTTTGCAAACCCGCCTGTGCAGGTGAAAGCGGATTTTGGTTC
rJMSF019C05+ AAAGGACATGGCTTGCCGCTTTGCAAACCCGCCTGTGCAGGTGAAAGCGGATTTTGGTTC
rJMSF031F20+ AAAGGACATGGCTTGCCGCTTTGCAAACCCGCCTGTGCAGGTGAAAGCGGATTTTGGTTC
rJMSF023I04+ AAAGGACATGGCTTGCCGCTTTGCAAACCCGCCTGTGCAGGTGAAAGCGGATTTTGGTTC
                      ____________________________________________________________
consensus AAAGGACATGGCTTGCCGCTTTGCAAACCCGCCTGTGCAGGTGAAAGCGGATTTTGGTTC
 
. : . : . : . : . : . :
rJMSF046G05+ TGTCATGGATGTTCTTAAGAAATACTTGTTGAGCAAAGATTCCAAGAAGTAGGTAATTTT
rJMSF031P22+ TGTCATGGATGTTCTTAAGAAATACTTGTTGAGCAAAGATTCCAAGAAGTAGGTAATTTT
rJMSF019C05+ TGTCATGGATGTTCTTAAGAAATACTTGTTGAGCAAAGATTCCAAGAAGTAGGTAATTTT
rJMSF031F20+ TGTCATGGATGTTCTTAAGAAATACTTGTTGAGCAAAGATTCCAAGAAGTAGGTAATTTT
rJMSF023I04+ TGTCATGGATGTTCTTAAGAAATACTTGTTGAGCAAAGATTCCAAGAAGTAGGTAATTTT
                      ____________________________________________________________
consensus TGTCATGGATGTTCTTAAGAAATACTTGTTGAGCAAAGATTCCAAGAAGTAGGTAATTTT
 
. : . : . : . : . : . :
rJMSF046G05+ TTCGTTTTGGTTATATATATTCTCTGGCAGGATAGTAAGTTTTGCTCATCTTCTATTGTT
rJMSF031P22+ TTCGTTTTGGTTATATATATTCTCTGGCAGGATAGTAAGTTTTGCTCATCTTCTATTGTT
rJMSF019C05+ TTCGTTTTGGTTATATATATTCTCTGGCAGGATAGTAAGTTTTGCTCATCTTCTATTGTT
rJMSF031F20+ TTCGTTTTGGTTATATATATTCTCTGGCAGGATAGTAAGTTTTGCTCATCTTCTATTGTT
rJMSF023I04+ TTCGTTTTGGTTATATATATTCTCTGGCAGGATAGTAAGTTTTGCTCATCTTCTATTGTT
                      ____________________________________________________________
consensus TTCGTTTTGGTTATATATATTCTCTGGCAGGATAGTAAGTTTTGCTCATCTTCTATTGTT
 
. : . : . : . : . : . :
rJMSF046G05+ GTTTACATGCTATATTATGTAGAATATGGT
rJMSF031P22+ GTTTACATGCTATATTATGTAGAATATGGTTGAATAATTTGTAGGGCCTGGGAATTTG
rJMSF019C05+ GTTTACATGCTATATTATGTAGAATATGGTTGAATAATTTGTAGGGCCTGGGAATTTGTT
rJMSF031F20+ GTTTACATGCTATATTATGTAGAATATGGTTGAATAATTTGTAGGGCCTGGGAATTTGTT
rJMSF023I04+ GTTTACATGCTATATTATGTAGAATATGGTTGAATAATTTGTAGGGCCTGGGAATTTGTT
                      ____________________________________________________________
consensus GTTTACATGCTATATTATGTAGAATATGGTTGAATAATTTGTAGGGCCTGGGAATTTGTT
 
. : . : . : . : . : . :
rJMSF019C05+ GTTCTAAAC
rJMSF031F20+ GTTCTAAAC
rJMSF023I04+ GTTCTAAACATATGTTGTGTGAAGACTATACAACTCATGAAGCTTTTTTTATGGAGTGTG
                      ____________________________________________________________
consensus GTTCTAAACATATGTTGTGTGAAGACTATACAACTCATGAAGCTTTTTTTATGGAGTGTG