Previous Contig 012309:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMSF023H24Sequence651006445 (12)gb:AY573574_16158384e-69Populus tremula x Populus tremuloides cellulose synthase (CesA3-2) mRNA, complet649012309 (3)pir|T10797|T107971e-41cellulose synthase (EC 2.4.1.-) catalytic chain celA1 - upland cotton>gb:AY63236
JMSF027F09Sequence673006445 (12)gb:AY573574_16158381e-73Populus tremula x Populus tremuloides cellulose synthase (CesA3-2) mRNA, complet649012309 (3)pir|T10797|T107975e-62cellulose synthase (EC 2.4.1.-) catalytic chain celA1 - upland cotton>gb:AY63236
JMSF037J11Sequence669006445 (12)gb:AY573574_16158389e-68Populus tremula x Populus tremuloides cellulose synthase (CesA3-2) mRNA, complet625012309 (3)pir|T10797|T107973e-54cellulose synthase (EC 2.4.1.-) catalytic chain celA1 - upland cotton>gb:AY63236

Alignment

This contig is upended


. : . : . : . : . : . :
rJMSF037J11+ GTCTTCCAAGGAATCCTCAAAATGATAGCGGGGATAG
rJMSF027F09+ GTCTTCCAAGGAATCCTCAAAATGATNGCGGGGATAG
                      ____________________________________________________________
consensus GTCTTCCAAGGAATCCTCAAAATGATAGCGGGGATAG
 
. : . : . : . : . : . :
rJMSF037J11+ ACACCANCNTCACCGTCACGGCGAAAGCGGCAGACGACGGAGAGTTCGGGGAGCTCTACC
rJMSF027F09+ ACACCAACTTCACNGTCACGGCGAAAGCGGCAGACGACGGAGAGTTCGGGGAGCTCTACC
rJMSF023H24+ GTCACGGCGAAAGCGGCAGACGACGGAGAGTTCGGGGAGCTCTACC
                      ____________________________________________________________
consensus ACACCAACTTCACCGTCACGGCGAAAGCGGCAGACGACGGAGAGTTCGGGGAGCTCTACC
 
. : . : . : . : . : . :
rJMSF037J11+ TCTTCAAGTGGANCACAGTCCTAATCCCTCCGACCACCATTCTCATCGTCAANTTGGTCG
rJMSF027F09+ TNTTCAAGTGGANCACAGTCCTAATCCCTCCGACCACCATTCTCATNGTCAACTTGGTCG
rJMSF023H24+ TCTTCAAGTGGACCACAGTCCTAATCCCTCCGACCACCNTTTTCATNGTCAACTTGGTCG
                      ____________________________________________________________
consensus TCTTCAAGTGGACCACAGTCCTAATCCCTCCGACCACCATTCTCATCGTCAACTTGGTCG
 
. : . : . : . : . : . :
rJMSF037J11+ GAGTTATCGCCGGCTTCTCCGACGCCCTCAACAGCGGCTACGAGTCCTGGGGGCCATNGT
rJMSF027F09+ GAGTTATCNCCGGCTTCTCCGACGCCCTCAACAGCGGCTACGAGTCCTGGGGGCCATTGT
rJMSF023H24+ GAGTTATCGCCGGNTTTTNCGACGCCCTCAACAGCGGNTACGAGTCCTGGGGGCCNTTGT
                      ____________________________________________________________
consensus GAGTTATCGCCGGCTTCTCCGACGCCCTCAACAGCGGCTACGAGTCCTGGGGGCCATTGT
 
. : . : . : . : . : . :
rJMSF037J11+ TCGGCAAAGTTTTNTTCTCGTTATGGGTCATNTTCCATCTCTACCCATTCTTGAAAGGTC
rJMSF027F09+ TCGGCAAAGTTNTNTTCTCGTTATGGGTCATNTTCCATCTCTACCCATTCTTGAAAGGTN
rJMSF023H24+ TNGGCAAAGTTTTNTTCTCGTTATGGGTCATNTTCCATCTCTACCCNTTCTTGAAAGGTN
                      ____________________________________________________________
consensus TCGGCAAAGTTTTNTTCTCGTTATGGGTCATNTTCCATCTCTACCCATTCTTGAAAGGTC
 
. : . : . : . : . : . :
rJMSF037J11+ TCATGGGTCGCCAGAATCGCACCCCCACCATTGTTGTGCTTTGGTCGGTGCTGTTGGCGT
rJMSF027F09+ TCATGGGTCGCCAGAATCGCACCCCCACCATTGTTGTGCTTTGGTCGGTGCTGTTGGCGT
rJMSF023H24+ TCATGGGTCGCCAGAATCGCACCCCCNCCNTTGTTGTGCTTTGGTCGGTGCTGTTGGNGT
                      ____________________________________________________________
consensus TCATGGGTCGCCAGAATCGCACCCCCACCATTGTTGTGCTTTGGTCGGTGCTGTTGGCGT
 
. : . : . : . : . : . :
rJMSF037J11+ CGGTTTTCTCGCTCATCTGGGTCAAGATCAATCCGTNNGTTGCCAAGAATGACCNTTCAA
rJMSF027F09+ CGGTTTTCTCGCTCATCTGGGTCAAGATCAATCCGNTTGTTGCCAAGAATGACCCTTCAA
rJMSF023H24+ CGGTTTTCTCGCTCATNTGGGTCAAGATCAATCCGTTTGTTGCCAAGAANGACCCTTCAA
                      ____________________________________________________________
consensus CGGTTTTCTCGCTCATCTGGGTCAAGATCAATCCGTTTGTTGCCAAGAATGACCCTTCAA
 
. : . : . : . : . : . :
rJMSF037J11+ CCTTGGCTCAGAACTGCATTTCCATTGACCGTAGTTGAGNTTAGCTTCCATGCATGGCCN
rJMSF027F09+ CCTTGGCTCAGAACTGCATTTCCATTGACCGTAGTTGAGNTTAGCTTCCANGCATGGCCG
rJMSF023H24+ CCTTGGCTCAGAACTGCATTTCCNTTGACTGTAGTTGAGCTTAGCTTCCNTGCATGGCCG
                      ____________________________________________________________
consensus CCTTGGCTCAGAACTGCATTTCCATTGACCGTAGTTGAGCTTAGCTTCCATGCATGGCCG
 
. : . : . : . : . : . :
rJMSF037J11+ CTGCAGAAGAAGAAGAAGTTATATATATCATGGTTNNGTGCTGGGACGACAGCCTTAATN
rJMSF027F09+ NTGCAGAAGAAGAAGAAGTTATATATATCATGGTTNNGTGCTGGGACGACAGCCTTAATN
rJMSF023H24+ CTGCAGAAGAAGAAGAAGTTATATATATCATGGTTTTGTGCTGGGACGACAGCCTTAATT
                      ____________________________________________________________
consensus CTGCAGAAGAAGAAGAAGTTATATATATCATGGTTTTGTGCTGGGACGACAGCCTTAATT
 
. : . : . : . : . : . :
rJMSF037J11+ AGATNTTCANGCTCNGCTCTCAATTTTTATACTTGCTGTTTTTGTGTTTGATTAGCATAA
rJMSF027F09+ AGATNTTCATGCTCNGCTCTCAATTTTTATACTTGCTGTTTTTGNGTTTGATTAGCATAA
rJMSF023H24+ AGATCTTCATGCTNTGCTCTCAANTTTTNTACNTGCTGNTTTTGNGTTTGATTAGCATAA
                      ____________________________________________________________
consensus AGATCTTCATGCTCTGCTCTCAATTTTTATACTTGCTGTTTTTGTGTTTGATTAGCATAA
 
. : . : . : . : . : . :
rJMSF037J11+ AACCACCAAGAATCGTGNTGACAATGCAAATGTNTNNTATTTGCTTTT
rJMSF027F09+ AACCACCAAGAATCGTGNTGACAATGCAAATGTNTANTATTTGCTTTTGAGTTTGATGGA
rJMSF023H24+ AACCCCCNAGAATTGTGTTGACAANGCAAATGTTTNTTATTTGCTTTTGAGTTTGATGGA
                      ____________________________________________________________
consensus AACCACCAAGAATCGTGTTGACAATGCAAATGTTTATTATTTGCTTTTGAGTTTGATGGA
 
. : . : . : . : . : . :
rJMSF027F09+ ATTTAATGT
rJMSF023H24+ ATTTAATGTACAAAATACAAAGGGAAATGAGAAAATTTGTAAAAAAGAAAAAAAAAAATA
                      ____________________________________________________________
consensus ATTTAATGTACAAAATACAAAGGGAAATGAGAAAATTTGTAAAAAAGAAAAAAAAAAATA