Previous Contig 012303:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF026G04Sequence641012303 (4)gb:AP005196_18492691e-66Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 7, PAC clone:P058
JMSF023G07Sequence679006143 (3)gb:YUP8H12_17312934e-04Arabidopsis thaliana chromosome 1 YAC yUP8H12 complete sequence.779012303 (4)gb:AP005196_18492699e-76Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 7, PAC clone:P058
JMSF048A17Sequence675006143 (3)gb:YUP8H12_17312930.002Arabidopsis thaliana chromosome 1 YAC yUP8H12 complete sequence.748012303 (4)gb:AP005196_18492691e-76Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 7, PAC clone:P058
JMSF051A21Sequence612006143 (3)gb:AE014186_9380600.006Plasmodium falciparum 3D7 chromosome 11 complete sequence.>gb:AE014837_1228794 P711012303 (4)gb:AP005196_18492695e-71Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 7, PAC clone:P058

Alignment

This contig is upended


. : . : . : . : . : . :
rJMSF051A21+ TCTAGTATGCCAAAAGTTTCATGCCCTACGTGCTCCAAGC
                      ____________________________________________________________
consensus TCTAGTATGCCAAAAGTTTCATGCCCTACGTGCTCCAAGC
 
. : . : . : . : . : . :
rJMSF051A21+ CACTCACAGCAGAACTATTAAATAGTAGTGGTANTAGAGATTCAANAAACNGANCACCAN
rJMSF048A17+ CACTCACAGCAGAACTATTAAATAGTAGTGGTAATAGAGATTCAAAAAACAGAACACCAA
rJMSF023G07+ CACTCACAGCAGAACTATTAAATAGTAGTGGTAATAGAGATTCAAAAANCAGAACAACAA
                      ____________________________________________________________
consensus CACTCACAGCAGAACTATTAAATAGTAGTGGTAATAGAGATTCAAAAAACAGAACACCAA
 
. : . : . : . : . : . :
rJMSF051A21+ TCAAAGGANTTAGGGCCTCGAGTATNCTGAACAGAANTNTGCTCGTNGAATTCCAGACTA
rJMSF048A17+ TCAAAGGATTTAGGGCCTCGAGTATACTGAACAGAATTCTGCTCGCTGAATTCCAGACTA
rJMSF023G07+ TCAAAGGATTTAGGGCCTCGAGTATACTGAACAGAATTCTGCTCGCTGAATTCCAGACTA
                      ____________________________________________________________
consensus TCAAAGGATTTAGGGCCTCGAGTATACTGAACAGAATTCTGCTCGCTGAATTCCAGACTA
 
. : . : . : . : . : . :
rJMSF051A21+ GTACTAAAATAGATGCCTTGAGGGAAGAAATNAGATTTANGGTTGAAAGAGATGGTTCTG
rJMSF048A17+ GTACTAAAATAGATGCCTTGAGGGAAGAAATTAGATTTATGGTTGAAAGAGATGGTTCTG
rJMFF026G04+ AATAGATGCCTNGAGGGANGAAATTAGATTTATGGNTGAAAGAGATGGTTCTG
rJMSF023G07+ GTACTAAAATAGATGCCTTGAGGGAAGAAATTAGATTTATGGTTGAAAGAGATGGTTCTG
                      ____________________________________________________________
consensus GTACTAAAATAGATGCCTTGAGGGAAGAAATTAGATTTATGGTTGAAAGAGATGGTTCTG
 
. : . : . : . : . : . :
rJMSF051A21+ CTAANGGAATAGTTTTCAGCCAATTCACAGAATTTTTGGATTTGATACACTATTCTCTTA
rJMSF048A17+ CTAAAGGAATAGTTTTCAGCCAATTCACAGAATTTTTGGATTTGATACACTATTCTCTTA
rJMFF026G04+ CTAAAGGAATAGTTTTCAGCCAATTCACAGAATTTTNGGATTTGATACACTATTCTCTTA
rJMSF023G07+ CTAAAGGAATAGTTTTCAGCCAATTCACAGAATTTTTGGATTTGATACACTATTCTCTTA
                      ____________________________________________________________
consensus CTAAAGGAATAGTTTTCAGCCAATTCACAGAATTTTTGGATTTGATACACTATTCTCTTA
 
. : . : . : . : . : . :
rJMSF051A21+ TCAAGTCGGGCGTTAATTGTGTTATGTTAATGGGATCANTGAGTATGGCCGCTAGAGAAT
rJMSF048A17+ TCAAGTCGGGCGTTAATTGTGTTATGTTAATGGGATCAATGAGTATGGCCGCTAGAGAAT
rJMFF026G04+ TCAAGTCGGGCGTTAATTGTGTTATGTTAATGGGATCAATGAGTATGGCCGCTAGAGAAT
rJMSF023G07+ TCAAGTCGGGCGTTAATTGTGTTATGTTAATGGGATCAATGAGTATGGCCGCTAGAGAAT
                      ____________________________________________________________
consensus TCAAGTCGGGCGTTAATTGTGTTATGTTAATGGGATCAATGAGTATGGCCGCTAGAGAAT
 
. : . : . : . : . : . :
rJMSF051A21+ CNGCTATTACTNAATTCACCGACGATCCAGAATGCAGAATATTTCTTATGAGTTTGAAAG
rJMSF048A17+ CTGCTATTACTAAATTCACCGACGATCCAGAATGCAGAATATTTCTTATGAGTTTGAAAG
rJMFF026G04+ CTGCTATTACTAAATTCACCGACGATCCAGAATGCAGAATATTTCTTATGAGTTTGAAAG
rJMSF023G07+ CTGCTATTACTAAATTCACCGACGATCCAGAATGCAGAATATTTCTTATGAGTTTGAAAG
                      ____________________________________________________________
consensus CTGCTATTACTAAATTCACCGACGATCCAGAATGCAGAATATTTCTTATGAGTTTGAAAG
 
. : . : . : . : . : . :
rJMSF051A21+ CTGGAGGTGTTGCTTTAAATCTGACAGTAGCATCGCATGTTTTCTTGATGGATCCTNGGT
rJMSF048A17+ CTGGAGGTGTTGCTTTAAATCTGACAGTAGCATCGCATGTTTTCTTGATGGATCCTTGGT
rJMFF026G04+ CTGGAGGTGTTGCTTTAAATCTGACAGTAGCATCGCATGTTTTCTTGATGGATCCTTGGT
rJMSF023G07+ CTGGAGGTGTTGCTTTAAATCTGACAGTAGCATCGCATGTTTTCTTGATGGATCCTTGGT
                      ____________________________________________________________
consensus CTGGAGGTGTTGCTTTAAATCTGACAGTAGCATCGCATGTTTTCTTGATGGATCCTTGGT
 
. : . : . : . : . : . :
rJMSF051A21+ GGAATCCAGCGGTGGAGAGGCAAGCACAAGATAGAATCCATCGGATAGGACAATATAAAC
rJMSF048A17+ GGAATCCAGCGGTGGAGAGGCAAGCACAAGATAGAATCCATCGGATAGGACAATATAAAC
rJMFF026G04+ GGAATCCAGCGGTGGAGAGGCAAGCACAAGATAGAATCCATCGGATAGGACAATATAAAC
rJMSF023G07+ GGAATCCAGCGGTGGAGAGGCAAGCACAAGATAGAATCCATCGGATAGGACAATATAAAC
                      ____________________________________________________________
consensus GGAATCCAGCGGTGGAGAGGCAAGCACAAGATAGAATCCATCGGATAGGACAATATAAAC
 
. : . : . : . : . : . :
rJMSF051A21+ CTATAAGGATTGTGAGATTTGTGATTGACAACACCATNGAAGAGAGAATCTTGAAGCTGC
rJMSF048A17+ CTATAAGGATTGTGAGATTTGTGATTGACAACACCATTGAAGAGAGAATCTTGAAGCTGC
rJMFF026G04+ CTATAAGGATTGTGAGATTTGTGATTGACAACACCATTGAAGAGAGAATCTTGAAGCTGC
rJMSF023G07+ CTATAAGGATTGTGAGATTTGTGATTGACAACACCATTGAAGAGAGAATCTTGAAGCTGC
                      ____________________________________________________________
consensus CTATAAGGATTGTGAGATTTGTGATTGACAACACCATTGAAGAGAGAATCTTGAAGCTGC
 
. : . : . : . : . : . :
rJMSF051A21+ AAGAGAAGAAGGAATTAGTTTTTGAAGGGACGGTTGGTGGATCCTTAGACGCACTTGGAA
rJMSF048A17+ AAGAGAAGAAGGAATTAGTTTTTGAAGGGACGGTTGGTGGATCCTTAGACGCACTTGGAA
rJMFF026G04+ AAGAGAAGAAGGAATTAGTTTTTGAAGGGACGGTTGGTGGATCCTTAGACGCACTTGGAA
rJMSF023G07+ AAGAGAAGAAGGAATTAGTTTTTGAAGGGACGGTTGGTGGATCCTTAGACGCACTTGGAA
                      ____________________________________________________________
consensus AAGAGAAGAAGGAATTAGTTTTTGAAGGGACGGTTGGTGGATCCTTAGACGCACTTGGAA
 
. : . : . : . : . : . :
rJMSF051A21+ AGCTAAGCGGAGGGAGNCTTGAAATTCCTTTTTGTCACTTGAAGCATGCACGCATATGTA
rJMSF048A17+ AGCTAA-CGGAGGGAGACTTGAAATTCCTTTTTGTCACTTGAAGCATGCATGCATATGTA
rJMFF026G04+ AGCTAA-CGGAGGGAGACTTGAAATTCCTTTTTGTCACTTGAAGCATGCATGCATATGTA
rJMSF023G07+ AGCTAA-CGGAGGGAGACTTGAAATTCCTTTTTGTCACTTGAAGCATGCATGCATATGTA
                      ____________________________________________________________
consensus AGCTAA-CGGAGGGAGACTTGAAATTCCTTTTTGTCACTTGAAGCATGCATGCATATGTA
 
. : . : . : . : . : . :
rJMSF051A21+ ATGT
rJMSF048A17+ ATGTTGTAAAATGTGTTTTTCCCTTACATCTGGAGCATATCATATCTTTTTTGCCATCTG
rJMFF026G04+ ATGTTGTAAAATGTGTTTTTCCCTTACATCTGGAGCATATCATATCTTTTTTGCCATCTG
rJMSF023G07+ ATGTTGTAAAATGTGTTTTTCCCTTACATCTGGAGCATATCATATCTTTTTTGCCATCTG
                      ____________________________________________________________
consensus ATGTTGTAAAATGTGTTTTTCCCTTACATCTGGAGCATATCATATCTTTTTTGCCATCTG
 
. : . : . : . : . : . :
rJMSF048A17+ TCTCAAGCATATCATTTCTATCAG
rJMFF026G04+ TCTCAAGCATATCATTTCTATCAGTAATCCTAACTCATCTTGATACAAA
rJMSF023G07+ TCTCAAGCATATCATTTCTATCAGTAATCCTAACTCATCTTGATACAAATATAATTGTCC
                      ____________________________________________________________
consensus TCTCAAGCATATCATTTCTATCAGTAATCCTAACTCATCTTGATACAAATATAATTGTCC