Previous Contig 012299:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF039D22Sequence759012299 (2)pir|T06628|T066285e-92hypothetical protein T20K18.50 - Arabidopsis thaliana>gb:ATCHRIV34_1545034 Arabi
JMSF023F13Sequence702001985 (4)pir|G84455|G844552e-51hypothetical protein At2g04280 [imported] - Arabidopsis thaliana>gb:AC007213_153772012299 (2)pir|T06628|T066289e-91hypothetical protein T20K18.50 - Arabidopsis thaliana>gb:ATCHRIV34_1545034 Arabi

Alignment

This contig is upended


. : . : . : . : . : . :
rJMFF039D22+ TGAAG
                      ____________________________________________________________
consensus TGAAG
 
. : . : . : . : . : . :
rJMFF039D22+ TTAGCCGAGTTGAAGGATACTTTAATCATGAGGAAGTTTGGCTCTGTGGAACCAGATAAT
rJMSF023F13+ GTTGAAGGATACTTTAATCATGAGGAAGTTTGGCTCTGTGGAACCAGATAAT
                      ____________________________________________________________
consensus TTAGCCGAGTTGAAGGATACTTTAATCATGAGGAAGTTTGGCTCTGTGGAACCAGATAAT
 
. : . : . : . : . : . :
rJMFF039D22+ TACTGGTACAGGGTGTGTGAGGGAGAGACTGAATCTGTTGTTCAACGGCCATGGCACCTG
rJMSF023F13+ TACTGGTACAGGGTGTGTGAGGGAGAGACTGAATCTGTTGTTCAACGGCCATGGCACCTG
                      ____________________________________________________________
consensus TACTGGTACAGGGTGTGTGAGGGAGAGACTGAATCTGTTGTTCAACGGCCATGGCACCTG
 
. : . : . : . : . : . :
rJMFF039D22+ ATATGGAAGTCGAGGAGGCTGATGGACATAGTTTCTGCAATTGCATCAAGGTTGAATTGG
rJMSF023F13+ ATATGGAAGTCGAGGAGGCTGATGGACATAGTTTCTGCAATTGCATCAAGGTTGAATTGG
                      ____________________________________________________________
consensus ATATGGAAGTCGAGGAGGCTGATGGACATAGTTTCTGCAATTGCATCAAGGTTGAATTGG
 
. : . : . : . : . : . :
rJMFF039D22+ GATTATGACTCTGTTCACATCGTGAGAGGTGAGAAGGCAAGCAATAAGGAACAGTGGCCA
rJMSF023F13+ GATTATGACTCTGTTCACATCGTGAGAGGTGAGAAGGCAAGCAATAAGGAACAGTGGCCA
                      ____________________________________________________________
consensus GATTATGACTCTGTTCACATCGTGAGAGGTGAGAAGGCAAGCAATAAGGAACAGTGGCCA
 
. : . : . : . : . : . :
rJMFF039D22+ CATCTGGCTGAAGATACTTCCCCCGAGGCTGTCATGTCCTCCTTGAAGGACAAAATCGAA
rJMSF023F13+ CATCTGGCTGAAGATACTTCCCCCGAGGCTGTCATGTCCTCCTTGAAGGACAAAATCGAA
                      ____________________________________________________________
consensus CATCTGGCTGAAGATACTTCCCCCGAGGCTGTCATGTCCTCCTTGAAGGACAAAATCGAA
 
. : . : . : . : . : . :
rJMFF039D22+ GATGGCAGGAACTTGTATGTTGCAACCGACGAACCAGACATATCATTTTTTGACCCTCTG
rJMSF023F13+ GATGGCAGGAACTTGTATGTTGCAACCGACGAACCAGACATATCATTTTTTGACCCTCTG
                      ____________________________________________________________
consensus GATGGCAGGAACTTGTATGTTGCAACCGACGAACCAGACATATCATTTTTTGACCCTCTG
 
. : . : . : . : . : . :
rJMFF039D22+ AAAGACAAGTATTCCACGCATTTTCTGAACGAATATAAAGATCAATGGGATGAAAACAGC
rJMSF023F13+ AAAGACAAGTATTCCACGCATTTTCTGAACGAATATAAAGATCAATGGGATGAAAACAGC
                      ____________________________________________________________
consensus AAAGACAAGTATTCCACGCATTTTCTGAACGAATATAAAGATCAATGGGATGAAAACAGC
 
. : . : . : . : . : . :
rJMFF039D22+ GAGTGGTATTCAGAGACAGCAAAGCTTAACGGTGGGAATCCCGTGGAATTCGACACTTAC
rJMSF023F13+ GAGTGGTATTCAGAGACAGCAAAGCTTAACGGTGGGAATCCCGTGGAATTCGACACTTAC
                      ____________________________________________________________
consensus GAGTGGTATTCAGAGACAGCAAAGCTTAACGGTGGGAATCCCGTGGAATTCGACACTTAC
 
. : . : . : . : . : . :
rJMFF039D22+ ATGAGAATCTCTGTTGATACAGAGGTTTTCTTGAGGGGTAAAAAGCAGGTAGAGACTTTT
rJMSF023F13+ ATGAGAATCTCTGTTGATACAGAGGTTTTCTTGAGGGGTAAAAAGCAGGTAGAGACTTTT
                      ____________________________________________________________
consensus ATGAGAATCTCTGTTGATACAGAGGTTTTCTTGAGGGGTAAAAAGCAGGTAGAGACTTTT
 
. : . : . : . : . : . :
rJMFF039D22+ AATGATCTCACCAAGGACTGCAAGGATGGGATTAACACTTGCACTTCCTCTACCTAATTT
rJMSF023F13+ AATGATCTCACCAAGGACTGCAAGGATGGGATTAACACTTGCACTTCCTCTACCTAATTT
                      ____________________________________________________________
consensus AATGATCTCACCAAGGACTGCAAGGATGGGATTAACACTTGCACTTCCTCTACCTAATTT
 
. : . : . : . : . : . :
rJMFF039D22+ CCTTCATGAAGTTCAAACTTAGCTGCTCTTGTGTTGGATAGATATGTGTAATTTTAATAT
rJMSF023F13+ CCTTCATGAAGTTCAAACTTAGCTGCTCTTGTGTTGGATAGATATGTGTAATTTTAATAT
                      ____________________________________________________________
consensus CCTTCATGAAGTTCAAACTTAGCTGCTCTTGTGTTGGATAGATATGTGTAATTTTAATAT
 
. : . : . : . : . : . :
rJMFF039D22+ ACCATGTTTGCTCTAGGACAGTTTTGCTTTGTGTTTGGCAGTTCAAAACGTTTGAAGCTT
rJMSF023F13+ ACCATGTTTGCTCTAGGACAGTTTTGCTTTGTGTTTGGCAGTTCAAAACGTTTGAAGCTT
                      ____________________________________________________________
consensus ACCATGTTTGCTCTAGGACAGTTTTGCTTTGTGTTTGGCAGTTCAAAACGTTTGAAGCTT
 
. : . : . : . : . : . :
rJMFF039D22+ CCCAAATCTTTGTACTTCTGGGGAGGAAAATAAG
rJMSF023F13+ CCCAAATCTTTGTACTTCTGGGGAGGAAAATAAGACTAAATTATTTTAATTGCCTGTGTT
                      ____________________________________________________________
consensus CCCAAATCTTTGTACTTCTGGGGAGGAAAATAAGACTAAATTATTTTAATTGCCTGTGTT