Previous Contig 012295:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMSF023E13Sequence294006136 (2)767012295 (2)gb:AY136303_15818041e-54Arabidopsis thaliana vacuolar sorting receptor-like protein (At4g20110) mRNA, co
JMSF044E09Sequence798006136 (2)pir|G86434|G864342e-82protein F17F8.23 [imported] - Arabidopsis thaliana>gb:AE005172_891945 Arabidopsi839012295 (2)gb:AP003628_18317085e-81Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 6, PAC clone:P047

Alignment

This contig is upended


. : . : . : . : . : . :
rJMSF044E09+ AATGGCG
                      ____________________________________________________________
consensus AATGGCG
 
. : . : . : . : . : . :
rJMSF044E09+ GGTGCTGGCATGATCCAAAATCTAACGTAACAGCCTGCAAGGACACATTTAGGGGAAGAG
                      ____________________________________________________________
consensus GGTGCTGGCATGATCCAAAATCTAACGTAACAGCCTGCAAGGACACATTTAGGGGAAGAG
 
. : . : . : . : . : . :
rJMSF044E09+ TATGCGAGTGCCCATCGATGAATGGTGTTCAGTACAAA-GGAGACGGATATACATCATGT
rJMSF023E13+ CATCGATGAATGGTGTTCAGTACAAAGGGAGACGGATATACATCATGT
                      ____________________________________________________________
consensus TATGCGAGTGCCCATCGATGAATGGTGTTCAGTACAAAGGGAGACGGATATACATCATGT
 
. : . : . : . : . : . :
rJMSF044E09+ GAAGCTGTTGGACCTGGAAGGTGCACGGTAAATAATGGCGGTTGCTGGTCAGAGACAAAA
rJMSF023E13+ GAAGCTGTTGGACCTGGAAGGTGCACGGTAAATAATGGCGG-TGCTGGTCAGAGACAAAA
                      ____________________________________________________________
consensus GAAGCTGTTGGACCTGGAAGGTGCACGGTAAATAATGGCGGTTGCTGGTCAGAGACAAAA
 
. : . : . : . : . : . :
rJMSF044E09+ GACAGAACAACTTTTTCTGCTTGCTCAGAAGCTCTTATTACCGGCTGTAAATGTCCCTAT
rJMSF023E13+ GACAGAACAACTTTTTCTGCTTGCTCAGAAGCTCTTATTACCGGCTGTAAATGTCCCTAT
                      ____________________________________________________________
consensus GACAGAACAACTTTTTCTGCTTGCTCAGAAGCTCTTATTACCGGCTGTAAATGTCCCTAT
 
. : . : . : . : . : . :
rJMSF044E09+ GGCTTTAAAGGGGATGGCCATAAATGTGAAGATGTAGACGAATGTAAGGAAGGCACGGTT
rJMSF023E13+ GGCTTTAAAGGGGATGGCCATAAATGTGAAGATGTAGACGAATGTAAGGAAGGCACGGTT
                      ____________________________________________________________
consensus GGCTTTAAAGGGGATGGCCATAAATGTGAAGATGTAGACGAATGTAAGGAAGGCACGGTT
 
. : . : . : . : . : . :
rJMSF044E09+ TGTCAGTGTGATGGTTGCAAGTGTAAGAACACATGGGGTGGATATGACTGCAAATGTAAA
rJMSF023E13+ TGTCAGTGTGATGGTTGCAAGTGTAAGAACACATGGGGTGGATATGACTGCAAATGTAAA
                      ____________________________________________________________
consensus TGTCAGTGTGATGGTTGCAAGTGTAAGAACACATGGGGTGGATATGACTGCAAATGTAAA
 
. : . : . : . : . : . :
rJMSF044E09+ GGAGATAAATTGTATATAATGGAGCATGACACATGCATTGAAAGACAGTCATCAAAACTT
rJMSF023E13+ GGAGATAAATTGTATATAATGGAGCATGACACATGCATTGAAAGACAGTCATCAAAACTT
                      ____________________________________________________________
consensus GGAGATAAATTGTATATAATGGAGCATGACACATGCATTGAAAGACAGTCATCAAAACTT
 
. : . : . : . : . : . :
rJMSF044E09+ GGAGGCTTCCTAACTTTTGCGGTTATAGCTGTTGTACTTGGTGCTGGAATAGCTGGATAC
rJMSF023E13+ GGAGGCTTCCTAACTTTTGCGGTTATAGCTGTTGTACTTGGTGCTGGAATAGCTGGATAC
                      ____________________________________________________________
consensus GGAGGCTTCCTAACTTTTGCGGTTATAGCTGTTGTACTTGGTGCTGGAATAGCTGGATAC
 
. : . : . : . : . : . :
rJMSF044E09+ ATATTCTACAAATACAGACTTAGGTCATACATGGACACAGAGATTATGGCTATCATGTCG
rJMSF023E13+ ATATTCTACAAATACAGACTTAGGTCATACATGGACACAGAGATTATGGCTATCATGTCG
                      ____________________________________________________________
consensus ATATTCTACAAATACAGACTTAGGTCATACATGGACACAGAGATTATGGCTATCATGTCG
 
. : . : . : . : . : . :
rJMSF044E09+ CAGTACATGCCTCTCGACAATAACCATCAGAATCAGGTTGTTCAACACGAAACTGAACCT
rJMSF023E13+ CAGTACATGCCTCTCGACAATAACCATCAGAATCAGGTTGTTCAACACGAAACTGAACCT
                      ____________________________________________________________
consensus CAGTACATGCCTCTCGACAATAACCATCAGAATCAGGTTGTTCAACACGAAACTGAACCT
 
. : . : . : . : . : . :
rJMSF044E09+ TTACGAGACGCCTCATCTGTATGAAGAAGCGTCTTGGTTGATTTGTTGACTATACAGAAT
rJMSF023E13+ TTACGAGACGCCTCATCTGTATGAAGAAGCGTCTTGGTTGATTTGTTGACTATACAGAAT
                      ____________________________________________________________
consensus TTACGAGACGCCTCATCTGTATGAAGAAGCGTCTTGGTTGATTTGTTGACTATACAGAAT
 
. : . : . : . : . : . :
rJMSF044E09+ GCATCAGTGATGCCGGTGAGACTCAACTTAACAGCTACACATTCGAGACAAGTCATATGG
rJMSF023E13+ GCATCAGTGATGCCGGTGAGACTCAACTTAACAGCTACACATTCGAGACAAGTCATATGG
                      ____________________________________________________________
consensus GCATCAGTGATGCCGGTGAGACTCAACTTAACAGCTACACATTCGAGACAAGTCATATGG
 
. : . : . : . : . : . :
rJMSF044E09+ TACGGTGTTTTATAGTCTCTACATCTAAATTCTGTCTGGTTCCACTCAATTACTTGAGGA
rJMSF023E13+ TACGGTGTTTTATAGTCTCTACATCTAAATTCTGTCTGGTTCCACTCAATTACTTGAGGN
                      ____________________________________________________________
consensus TACGGTGTTTTATAGTCTCTACATCTAAATTCTGTCTGGTTCCACTCAATTACTTGAGGA
 
. : . : . : . : . : . :
rJMSF044E09+ TATAGATTATATCAATAACCGAGCTCGCTGCGTTTGTGTATAAAATGGATCTA
rJMSF023E13+ TATCGATNATATCAATAACCGAGCTCGCTGCGTTTGTGCATAAAATGGATCTACAGAGTA
                      ____________________________________________________________
consensus TATCGATTATATCAATAACCGAGCTCGCTGCGTTTGTGTATAAAATGGATCTACAGAGTA