Previous Contig 012294:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMSF023D24Sequence641012294 (2)pir|T50562|T505622e-52SINA2 protein [imported] - Vitis vinifera>gb:VVI18472_1727496 Vitis vinifera mRN769012294 (2)pir|T50562|T50562e-115SINA2 protein [imported] - Vitis vinifera>gb:VVI18472_1727496 Vitis vinifera mRN

Alignment

This contig is upended


. : . : . : . : . : . :
JMSF023D24- GGCACTGAATATTTCTGCAC
                      ____________________________________________________________
consensus GGCACTGAATATTTCTGCAC
 
. : . : . : . : . : . :
JMSF023D24- ACCATAGAAGACGTTTAGATAGTACAGTATATTGTTGTCGCTACCAGATTGGGCGTGTCT
                      ____________________________________________________________
consensus ACCATAGAAGACGTTTAGATAGTACAGTATATTGTTGTCGCTACCAGATTGGGCGTGTCT
 
. : . : . : . : . : . :
JMSF023D24- ATGTAAACAGAACAGAGGACTCAGAAAGTCAGCTCGCTCAAAGTATTTGATCGATCATGG
                      ____________________________________________________________
consensus ATGTAAACAGAACAGAGGACTCAGAAAGTCAGCTCGCTCAAAGTATTTGATCGATCATGG
 
. : . : . : . : . : . :
JMSF023D24- CTCCCGGAGGTGGAGCTTGTAGAGAAGTGGTGGAAACACAGCCGAAGTCTGCGAATTTTG
                      ____________________________________________________________
consensus CTCCCGGAGGTGGAGCTTGTAGAGAAGTGGTGGAAACACAGCCGAAGTCTGCGAATTTTG
 
. : . : . : . : . : . :
JMSF023D24- ATATGGCAACGAAACGGCGACCAGAGAAAAGCAGGGCTCTGGTGAAGTATGCCGGCGGGA
                      ____________________________________________________________
consensus ATATGGCAACGAAACGGCGACCAGAGAAAAGCAGGGCTCTGGTGAAGTATGCCGGCGGGA
 
. : . : . : . : . : . :
JMSF023D24- GAGGCGACAAGATGGATGGGCCTTTGAATTATGACGTGCACCAGCTGCTGGAGTGCCCCG
                      ____________________________________________________________
consensus GAGGCGACAAGATGGATGGGCCTTTGAATTATGACGTGCACCAGCTGCTGGAGTGCCCCG
 
. : . : . : . : . : . :
JMSF023D24- TCTGCAGAAATTCGATGCTTCCACCGATTTTTCAGTGTCCAAAGGGGCACACCCTATGCG
rJMSF023D24+ GATGCTTCCACCGATTTTTCAGTGTCCAAAGGGGCACACCCTATGCG
                      ____________________________________________________________
consensus TCTGCAGAAATTCGATGCTTCCACCGATTTTTCAGTGTCCAAAGGGGCACACCCTATGCG
 
. : . : . : . : . : . :
JMSF023D24- CAAGCTGCAATGGAGCGCACAAGATTTGCCCGACTTGCCAATCTGAGATGGGAGACATCA
rJMSF023D24+ CAAGCTGCAATGGAGCGCACAAGATTTGCCCGACTTGCCAATCTGAGATGGGAGACATCA
                      ____________________________________________________________
consensus CAAGCTGCAATGGAGCGCACAAGATTTGCCCGACTTGCCAATCTGAGATGGGAGACATCA
 
. : . : . : . : . : . :
JMSF023D24- GGTGCTTAGTCCTGGAAAAAGTGGCCGACTCTTTGGATCTTCCCTGCAGATTCCAAAGCG
rJMSF023D24+ GGTGCTTAGTCCTGGAAAAAGTGGCCGACTCTTTGGATCTTCCCTGCAGATTCCAAAGCG
                      ____________________________________________________________
consensus GGTGCTTAGTCCTGGAAAAAGTGGCCGACTCTTTGGATCTTCCCTGCAGATTCCAAAGCG
 
. : . : . : . : . : . :
JMSF023D24- CCGGCTGTGATCATATATTTCCGTATTACAGGAAGCTGAATCACGAAAAACGTTGTAGAT
rJMSF023D24+ CCGGCTGTGATCATATATTTCCGTATTACAGGAAGCTGAATCACGAAAAACGTTGTAGAT
                      ____________________________________________________________
consensus CCGGCTGTGATCATATATTTCCGTATTACAGGAAGCTGAATCACGAAAAACGTTGTAGAT
 
. : . : . : . : . : . :
JMSF023D24- TCCGCCCCTACAATTGCCCCTACGCAGGATCAGAGTGTTGCGTCACCGGCGACATCCCAG
rJMSF023D24+ TCCGCCCCTACAATTGCCCCTACGCAGGATCAGAGTGTTGCGTCACCGGCGACATCCCAG
                      ____________________________________________________________
consensus TCCGCCCCTACAATTGCCCCTACGCAGGATCAGAGTGTTGCGTCACCGGCGACATCCCAG
 
. : . : . : . : . : . :
JMSF023D24- CCCTGGTAAAGCATCTCAGGG
rJMSF023D24+ CCCTGGTAAAGCATCTCAGGGAGGATCACAAGGTCGACATGCATAACGGCTGCACCTTTA
                      ____________________________________________________________
consensus CCCTGGTAAAGCATCTCAGGGAGGATCACAAGGTCGACATGCATAACGGCTGCACCTTTA
 
. : . : . : . : . : . :
rJMSF023D24+ ACCATCGCTATGTCAAGTCAGATCCTCAACAAGTTGAAAACGCAACATGGATGCTCACTG
                      ____________________________________________________________
consensus ACCATCGCTATGTCAAGTCAGATCCTCAACAAGTTGAAAACGCAACATGGATGCTCACTG
 
. : . : . : . : . : . :
rJMSF023D24+ TGTTTGACTGTCATGGAAAGCAGTTCTGCTTGCATTTTGAGGCATTCCCTCTGGGAACGA
                      ____________________________________________________________
consensus TGTTTGACTGTCATGGAAAGCAGTTCTGCTTGCATTTTGAGGCATTCCCTCTGGGAACGA
 
. : . : . : . : . : . :
rJMSF023D24+ CGCCGGTGTACATGGCCTTTCTGCGGTTCATGGGCGAAGATGGCGAGGCTAAATTGTTCA
                      ____________________________________________________________
consensus CGCCGGTGTACATGGCCTTTCTGCGGTTCATGGGCGAAGATGGCGAGGCTAAATTGTTCA
 
. : . : . : . : . : . :
rJMSF023D24+ GCTATAGTTTGGAAGTAGGCGGGCATGGGCGCAAACTGACATGGCAAGGAGTGCCAAGGA
                      ____________________________________________________________
consensus GCTATAGTTTGGAAGTAGGCGGGCATGGGCGCAAACTGACATGGCAAGGAGTGCCAAGGA
 
. : . : . : . : . : . :
rJMSF023D24+ GTATCCGTGAAAGCCATAGACAGGTTCGGGATAGTCAAGATGGGCTCATAATTCCAAGAA
                      ____________________________________________________________
consensus GTATCCGTGAAAGCCATAGACAGGTTCGGGATAGTCAAGATGGGCTCATAATTCCAAGAA
 
. : . : . : . : . : . :
rJMSF023D24+ CCATAGCGCTTTACTTCTCCGCCGGCGATGCCCAAGAGCTTAAGCTAAAGGTAACAGGTC
                      ____________________________________________________________
consensus CCATAGCGCTTTACTTCTCCGCCGGCGATGCCCAAGAGCTTAAGCTAAAGGTAACAGGTC
 
. : . : . : . : . : . :
rJMSF023D24+ GAATATGGAAGGAGCAGTAATATAATAAGCTTCTATAAGCTCATCTCATCTGCTTATTAT
                      ____________________________________________________________
consensus GAATATGGAAGGAGCAGTAATATAATAAGCTTCTATAAGCTCATCTCATCTGCTTATTAT