Previous Contig 012291:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMSF009P18Sequence257005118 (3)604012291 (3)gb:AF026150_17621783e-52Perilla frutescens beta-ketoacyl-ACP synthase IIIA (KAS IIIA) mRNA, complete cds
JMSF023C03Sequence660005118 (3)gb:AF260565_17814721e-40Glycine max beta-ketoacyl-acyl carrier protein synthase III mRNA, complete cds.803012291 (3)gb:AF026150_17621781e-77Perilla frutescens beta-ketoacyl-ACP synthase IIIA (KAS IIIA) mRNA, complete cds
JMSF023D06Sequence634005118 (3)gb:AF260565_17814722e-32Glycine max beta-ketoacyl-acyl carrier protein synthase III mRNA, complete cds.792012291 (3)gb:AF026150_17621781e-75Perilla frutescens beta-ketoacyl-ACP synthase IIIA (KAS IIIA) mRNA, complete cds

Alignment

This contig is upended


. : . : . : . : . : . :
rJMSF023C03+ CTAGTGCAGGCCTGTGACATTGCA
rJMSF023D06+ TGTGACATTGCA
                      ____________________________________________________________
consensus CTAGTGCAGGCCTGTGACATTGCA
 
. : . : . : . : . : . :
rJMSF023C03+ GAAGATGGTTTATTCGCTTTCGACTTGCATAGTGATGGTGAGGGTCAAAGGCACTTAAAT
rJMSF023D06+ GAAGATGGTTTATTCGCTTTCGACTTGCATAGTGATGGTGAGGGTCAAAGGCACTTAAAT
                      ____________________________________________________________
consensus GAAGATGGTTTATTCGCTTTCGACTTGCATAGTGATGGTGAGGGTCAAAGGCACTTAAAT
 
. : . : . : . : . : . :
rJMSF023C03+ GCTTCTCTAAAAGAGAACGAAACAGATAAAAAAGTGGGAACAAATGGTTCACTAATTGGT
rJMSF023D06+ GCTTCTTTAAAAGAGAACGAAACAGATAAAAAAGTGGGAACAAATGGTTCACTAATTGGT
                      ____________________________________________________________
consensus GCTTCTTTAAAAGAGAACGAAACAGATAAAAAAGTGGGAACAAATGGTTCACTAATTGGT
 
. : . : . : . : . : . :
rJMSF009P18+ TCCTGCATTCAAATGAATGGTAAGGAGGTCTTCAGG
rJMSF023C03+ TTCCCACCAAAAAGCTCCAACTTTTCCTGCATTCAAATGAATGGTAAGGAGGTCTTCAGG
rJMSF023D06+ TTCCCACCAAAAAGCTCCAACTTTTCCTGCATTCAAATGAATGGTAAGGAGGTCTTCAGG
                      ____________________________________________________________
consensus TTCCCACCAAAAAGCTCCAACTTTTCCTGCATTCAAATGAATGGTAAGGAGGTCTTCAGG
 
. : . : . : . : . : . :
rJMSF009P18+ TTTGNTGTTCGAGTTGTGCCGCAGTCCATTGAAGCTTCCTTACAGAAAGCCGGTCTGACT
rJMSF023C03+ TTTGCTGTTCGAGTTGTGCCGCAGTCCATTGAAGCTTCCTTACAGAAAGCCGGTCTGACT
rJMSF023D06+ TTTGCTGTTCGAGTTGTGCCGCAGTCCATTGAAGCTTCCTTACAGAAAGCCGGTCTGACT
                      ____________________________________________________________
consensus TTTGCTGTTCGAGTTGTGCCGCAGTCCATTGAAGCTTCCTTACAGAAAGCCGGTCTGACT
 
. : . : . : . : . : . :
rJMSF009P18+ AACTCCANCATTGATTGGTTACTTNTCCATCAGGCAAACCAAAGGATTATTGATGCAGTG
rJMSF023C03+ AACTCCAGCATTGATTGGTTACTTCTCCATCAGGCAAACCAAAGGATTATTGATGCAGTG
rJMSF023D06+ AACTCCAGCATTGATTGGTTACTTCTCCATCAGGCAAACCAAAGGATTATTGATGCAGTG
                      ____________________________________________________________
consensus AACTCCAGCATTGATTGGTTACTTCTCCATCAGGCAAACCAAAGGATTATTGATGCAGTG
 
. : . : . : . : . : . :
rJMSF009P18+ GCAACGCGTTTGGATATCCCATCCGAACACGTGATATCAAATTTGTCCAACTATGGCAAT
rJMSF023C03+ GCAACGCGTTTGGATATCCCATCCGAACACGTGATATCAAATTTGTCCAACTATGGCAAT
rJMSF023D06+ GCAACGCGTTTGGATATCCCATCCGAACACGTGATATCAAATTTGTCCAACTATGGCAAT
                      ____________________________________________________________
consensus GCAACGCGTTTGGATATCCCATCCGAACACGTGATATCAAATTTGTCCAACTATGGCAAT
 
. : . : . : . : . : . :
rJMSF009P18+ ACTAGTGCTGCTTCCATCCCATTGGCATTGGACGAAGCTGTTCGCAGCGGAAAAGTTCAG
rJMSF023C03+ ACTAGTGCTGCTTCCATCCCATTGGCATTGGACGAAGCTGTTCGCAGCGGAAAAGTTCAG
rJMSF023D06+ ACTAGTGCTGCTTCCATCCCATTGGCATTGGACGAAGCTGTTCGCAGCGGAAAAGTTCAG
                      ____________________________________________________________
consensus ACTAGTGCTGCTTCCATCCCATTGGCATTGGACGAAGCTGTTCGCAGCGGAAAAGTTCAG
 
. : . : . : . : . : . :
rJMSF009P18+ GCGGGCCATACAATCGCTGNTGCTGGGTTCGGTGCTGGTCTTACGTGGGGCTCTGCCATC
rJMSF023C03+ GCGGGCCATACAATCGCTGCTGCTGGGTTCGGTGCTGGTCTTACGTGGGGCTCTGCCATC
rJMSF023D06+ GCGGGCCATACAATCGCTGCTGCTGGGTTCGGTGCTGGTCTTACGTGGGGCTCTGCCATC
                      ____________________________________________________________
consensus GCGGGCCATACAATCGCTGCTGCTGGGTTCGGTGCTGGTCTTACGTGGGGCTCTGCCATC
 
. : . : . : . : . : . :
rJMSF009P18+ ATGAGATGGGGANGAACCTACAACGTGTTGATGGGCGGTGTATAATATCGAGAGGTGGTT
rJMSF023C03+ ATGAGATGGGGATGAACCTACAACGTGTTGATGGGCGGTGTATAATATCGAGAGGTGGTT
rJMSF023D06+ ATGAGATGGGGATGAACCTACAACGTGTTGATGGGCGGTGTATAATATCGAGAGGTGGTT
                      ____________________________________________________________
consensus ATGAGATGGGGATGAACCTACAACGTGTTGATGGGCGGTGTATAATATCGAGAGGTGGTT
 
. : . : . : . : . : . :
rJMSF009P18+ GATAATTTTGTGCCTTTTAGATTAGCCTGCCTTGTCACTGTGAAGCTTCAACATGAATTT
rJMSF023C03+ GATAATTTTGTGCCTTTTAGATTAGCCTGCCTTGTCACTGTGAAGCTTCAACATGAATTT
rJMSF023D06+ GATAATTTTGTGCCTTTTAGATTAGCCTGCCTTGTCACTGTGAAGCTTCAACATGAATTT
                      ____________________________________________________________
consensus GATAATTTTGTGCCTTTTAGATTAGCCTGCCTTGTCACTGTGAAGCTTCAACATGAATTT
 
. : . : . : . : . : . :
rJMSF009P18+ TTCATCGCAATTTCATTCTGCATTAAATTTGACCGGTTTCAATAAAATCTCATGCATTCC
rJMSF023C03+ TTCATCGCAATTTCATTCTGCATTAAATTTGACCGGTTTCAATAAAATCTCATGCATTCC
rJMSF023D06+ TTCATCGCAATTTCATTCTGCATTAAATTTGACCGGTTTCAATAAAATCTCATGCATTCC
                      ____________________________________________________________
consensus TTCATCGCAATTTCATTCTGCATTAAATTTGACCGGTTTCAATAAAATCTCATGCATTCC
 
. : . : . : . : . : . :
rJMSF009P18+ CCTCACTTGTGTTGTCATTGCATTATTGAACACTTGAACCCCTTTGAGTAGAATAGAAGA
rJMSF023C03+ CCTCACTTGTGTTGTCATTGCATTATTGAACACTTGAACCCCTTTGAGTAGAATAGAAGA
rJMSF023D06+ CCTCACTTGTGTTGTCATTGCATTATTGAATACTTGAACCCCTTTGAGTAGAATAGAAGA
                      ____________________________________________________________
consensus CCTCACTTGTGTTGTCATTGCATTATTGAACACTTGAACCCCTTTGAGTAGAATAGAAGA
 
. : . : . : . : . : . :
rJMSF009P18+ AGATATCAATTATGTAATTTT
rJMSF023C03+ AGATATCAATTATGTAATTTTTGGCTTTGAACTCACATTCTTTAATTTGTGTAAGAATA
rJMSF023D06+ AGATATCAATTATGTAATTTTTGGCTTTGAACTCACATTCTTTAATTTGTGTAAGAATAT
                      ____________________________________________________________
consensus AGATATCAATTATGTAATTTTTGGCTTTGAACTCACATTCTTTAATTTGTGTAAGAATAT