Previous Contig 012283:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMSF023A10Sequence717006114 (2)gb:AK175144_18171321e-11Arabidopsis thaliana mRNA for hypothetical protein, complete cds, clone: RAFL21-751012283 (2)
JMSF040F24Sequence659006114 (2)gb:AK175144_18171323e-12Arabidopsis thaliana mRNA for hypothetical protein, complete cds, clone: RAFL21-794012283 (2)

Alignment

This contig is upended


. : . : . : . : . : . :
rJMSF040F24+ GACCAGAGGACAAGATTTATCGGATTCAAAACAGCTGCA
                      ____________________________________________________________
consensus GACCAGAGGACAAGATTTATCGGATTCAAAACAGCTGCA
 
. : . : . : . : . : . :
rJMSF040F24+ GAACCCAGATTTTCGTGTCGTTTCCCACTCAAGGAATGGTTAATGGCAGTAGTAATGCTA
rJMSF023A10+ AGGAATGGTTAATGGCAGTAGTAATGCTA
                      ____________________________________________________________
consensus GAACCCAGATTTTCGTGTCGTTTCCCACTCAAGGAATGGTTAATGGCAGTAGTAATGCTA
 
. : . : . : . : . : . :
rJMSF040F24+ CTAGAGCTGGACAAACCATTGAAGCCTCAAAACAACTACATGTTCCTCACATAGCATCAG
rJMSF023A10+ CTAGAGCTGGACAAACCATTGAAGCCTCAAAACAACTACATGTTCCTCACATAGCATCAG
                      ____________________________________________________________
consensus CTAGAGCTGGACAAACCATTGAAGCCTCAAAACAACTACATGTTCCTCACATAGCATCAG
 
. : . : . : . : . : . :
rJMSF040F24+ AGAACCAGCAACTATCTTTCCTGCTTCCCCAGAATCGTTATTCATCTGCTTCTTTTGGCC
rJMSF023A10+ AGAACCAGCAACTATCTTTCCTGCTTCCCCAGAATCGTTATTCATCTGCTTCTTTTGGCC
                      ____________________________________________________________
consensus AGAACCAGCAACTATCTTTCCTGCTTCCCCAGAATCGTTATTCATCTGCTTCTTTTGGCC
 
. : . : . : . : . : . :
rJMSF040F24+ CGCTTTCTTCAACAGCTGCAGCTCATCAGGTTCTATTGCCACAAGTTGGGAATGCAGACG
rJMSF023A10+ CGCTTTCTTCAACAGCTGCAGCTCATCAGGTTCTATTGCCACAAGTTGGGAATGCAGACG
                      ____________________________________________________________
consensus CGCTTTCTTCAACAGCTGCAGCTCATCAGGTTCTATTGCCACAAGTTGGGAATGCAGACG
 
. : . : . : . : . : . :
rJMSF040F24+ CCACAGTTCCACCAAGACTACAACTCCACAGGCAAGAAATACAAATTTGGCCTACCCACC
rJMSF023A10+ CCACAGTTCCACCAAGACTACAACTCCACAGGCAAGAAATACAAATTTGGCCTACCCACC
                      ____________________________________________________________
consensus CCACAGTTCCACCAAGACTACAACTCCACAGGCAAGAAATACAAATTTGGCCTACCCACC
 
. : . : . : . : . : . :
rJMSF040F24+ TCACAGCTGCATACAAGCATGGTGAAGTCGGTGCCTCCCATATACCGGAGTGGCAAAACG
rJMSF023A10+ TCACAGCTGCATACAAGCATGGTGAAGTCGGTGCCTCCCATATACCGGAGTGGCAAAACG
                      ____________________________________________________________
consensus TCACAGCTGCATACAAGCATGGTGAAGTCGGTGCCTCCCATATACCGGAGTGGCAAAACG
 
. : . : . : . : . : . :
rJMSF040F24+ GAGGACAAAACACGCATCCCCTTCTCCAATCCGCTCAAACCATGTTCCCAGGCTCTCGTT
rJMSF023A10+ GAGGACAAAACACGCATCCCCTTCTCCAATCCGCTCAAACCATGTTCCCAGGCTCTCGTT
                      ____________________________________________________________
consensus GAGGACAAAACACGCATCCCCTTCTCCAATCCGCTCAAACCATGTTCCCAGGCTCTCGTT
 
. : . : . : . : . : . :
rJMSF040F24+ CTTCCTTGGACACGCTTCCCTCCAAGCACGCTCCCATCTCACTTGAACAGCAGCAGCGGC
rJMSF023A10+ CTTCCTTGGACACGCTTCCCTCCAAGCACGCTCCCATCTCACTTGAACAGCAGCAGCGGC
                      ____________________________________________________________
consensus CTTCCTTGGACACGCTTCCCTCCAAGCACGCTCCCATCTCACTTGAACAGCAGCAGCGGC
 
. : . : . : . : . : . :
rJMSF040F24+ TTATGCCCATTTCCTCATCGCTATCAGGCTCAAGGGTAAGAGGACAGTACTATCGTTTAC
rJMSF023A10+ TTATGCCCATTTCCTCATCGCTATCAGGCTCAAGGGTAAGAGGACAGTACTATCGTTTAC
                      ____________________________________________________________
consensus TTATGCCCATTTCCTCATCGCTATCAGGCTCAAGGGTAAGAGGACAGTACTATCGTTTAC
 
. : . : . : . : . : . :
rJMSF040F24+ CTGATGGCTTTGAAGGGAATGCCCGGGGACTCTACCCGAACAGCATCCCAGCGTTGCAAA
rJMSF023A10+ CTGATGGCTTTGAAGGGAATGCCCGGGGACTCTACCCGAACAGCATCCCAGCGTTGCAAA
                      ____________________________________________________________
consensus CTGATGGCTTTGAAGGGAATGCCCGGGGACTCTACCCGAACAGCATCCCAGCGTTGCAAA
 
. : . : . : . : . : . :
rJMSF040F24+ TGCTCTGCAATGGTCACCATTAGAACGATCACCATTGATTTATTCTTTTCTTTTTGTAGA
rJMSF023A10+ TGCTCTGCAATGGTCACCATTAGAACGATCACCATTGATTTATTCTTTTCTTTTTGTAGA
                      ____________________________________________________________
consensus TGCTCTGCAATGGTCACCATTAGAACGATCACCATTGATTTATTCTTTTCTTTTTGTAGA
 
. : . : . : . : . : . :
rJMSF040F24+ TGCATATTGAGCAAGAACTAATGCCAGTAGCCAGTGTTGAGCACACACACATATATATAT
rJMSF023A10+ TGCATATTGAGCAAGAACTAATGCCAGTAGCCAGTGTTGAGCACACATACATATATATAT
                      ____________________________________________________________
consensus TGCATATTGAGCAAGAACTAATGCCAGTAGCCAGTGTTGAGCACACATACATATATATAT
 
. : . : . : . : . : . :
rJMSF040F24+ TGAAAAATTCTTATGGTATCTGTTATTACCC
rJMSF023A10+ TGAAAAATTCTTATGGTATCTGTTNTTACCCNTTTTAGCAATTGAANGATCAGAAAAAAC
                      ____________________________________________________________
consensus TGAAAAATTCTTATGGTATCTGTTATTACCCNTTTTAGCAATTGAANGATCAGAAAAAAC