Previous Contig 012279:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF043G17Sequence635001848 (2)gb:AF216852_17781052e-74Zea mays delta-COP mRNA, complete cds.610012279 (3)sp|P49661|COPD_ORYSA3e-42Coatomer delta subunit (Delta-coat protein) (Delta-COP) (Archain).>pir|T03598|T0
JMSF022O10Sequence644001848 (2)gb:AF216852_17781054e-78Zea mays delta-COP mRNA, complete cds.723012279 (3)sp|P49661|COPD_ORYSA3e-38Coatomer delta subunit (Delta-coat protein) (Delta-COP) (Archain).>pir|T03598|T0
JMSF024O07Sequence656001820 (2)gb:AF216852_17781052e-76Zea mays delta-COP mRNA, complete cds.744012279 (3)gb:AY054464_15631193e-69Arabidopsis thaliana coatomer delta subunit (delta-coat protein) (delta-COP) (At

Alignment

This contig is upended


. : . : . : . : . : . :
rJMSF024O07+ ANGGA
                      ____________________________________________________________
consensus ANGGA
 
. : . : . : . : . : . :
rJMSF024O07+ GTTGTTTGCAAATGAAAATATTCTAGGCCTCAAAGATCCAAATAGGCCATTTCCCACTGG
                      ____________________________________________________________
consensus GTTGTTTGCAAATGAAAATATTCTAGGCCTCAAAGATCCAAATAGGCCATTTCCCACTGG
 
. : . : . : . : . : . :
rJMSF024O07+ TCAATCTGGTGATGGTGTTGGTCTCTTGAAGTGGAGAATGCAAAGCACTGATGAGTCAAT
                      ____________________________________________________________
consensus TCAATCTGGTGATGGTGTTGGTCTCTTGAAGTGGAGAATGCAAAGCACTGATGAGTCAAT
 
. : . : . : . : . : . :
rJMSF024O07+ TTTGCCATTGACACTTAACTGCTGGCCCTCTGCTTCTGGAAAAGAAACCTATGTCAATAT
rJMFF043G17+ T
                      ____________________________________________________________
consensus TTTGCCATTGACACTTAACTGCTGGCCCTCTGCTTCTGGAAAAGAAACCTATGTCAATAT
 
. : . : . : . : . : . :
rJMSF024O07+ TGAGTATGAAACTCCAGCAAACATGCAACTACAGAATGTTATAATTTCTGTGCCTCTTCC
rJMFF043G17+ TGAGTATGAAACTCCAGCAAACATGNATCTTCAGAATGTNATAGTTTCTGTGCCTCTCCC
rJMSF022O10+ CTCCC
                      ____________________________________________________________
consensus TGAGTATGAAACTCCAGCAAACATGCATCTTCAGAATGTTATAGTTTCTGTGCCTCTCCC
 
. : . : . : . : . : . :
rJMSF024O07+ AGCACTTAGAGATGCTCCAAATGTACAGCAGATAGACGGGGAGTGGAGGTTTGACTCCAG
rJMFF043G17+ AGCTCTCAGAGAGGCCCCAAACGTACAGCAGATTGATGGGGATNGGAGGTATGATTCCAG
rJMSF022O10+ AGCTCTCAGAGAGGCCCCAAACGTACAGCAGATTGATGGGGATTGGAGGTATGATTCCAG
                      ____________________________________________________________
consensus AGCTCTCAGAGAGGCCCCAAACGTACAGCAGATTGATGGGGATTGGAGGTATGATTCCAG
 
. : . : . : . : . : . :
rJMSF024O07+ GAATTGTGTCCTGGAATGGTCTATAGTTCTCATTGATAACTCAAATCGCAGTGGTTCTCT
rJMFF043G17+ AAATTCTGTTCTGGAATGGTCTATAGATCTCATCGATGCCTCAAATCGCAGTGGATCTCT
rJMSF022O10+ AAATTCTGTTCTGGAATGGTCTATAGATCTCATCGATGCCTCAAATCGCAGTGGATCTCT
                      ____________________________________________________________
consensus AAATTCTGTTCTGGAATGGTCTATAGATCTCATCGATGCCTCAAATCGCAGTGGATCTCT
 
. : . : . : . : . : . :
rJMSF024O07+ AGAATTTGTTGTTCCTGCAGCAGACCCATCACAGTTTTTCCCAATAAGTGCACGCTTTAC
rJMFF043G17+ AGAATTTGTTGTTCCTGCAGCTGATCCATCATCCTTTTTCCCAATATCTGCCCGTTTCAC
rJMSF022O10+ AGAATTTGTTGTTCCTGCAGCTGATCCATCATCCTTTTTCCCAATATCTGCCCGTTTCAC
                      ____________________________________________________________
consensus AGAATTTGTTGTTCCTGCAGCTGATCCATCATCCTTTTTCCCAATATCTGCCCGTTTCAC
 
. : . : . : . : . : . :
rJMSF024O07+ TTCTTCAAGAACTTTTAGCGACTTGAAGGTTGTCAATATTCTTCCGCTGAGAGGTGGGGC
rJMFF043G17+ CTCTTCAAAAACTTTCAGCGACTTGAAGGTTACCAACATTTTGCCGCTGAGAGGTGGGGC
rJMSF022O10+ CTCTTCAAAAACTTTCAGCGACTTGAAGGTTACCAACATTTTGCCGCTGAGAGGTGGGGC
                      ____________________________________________________________
consensus CTCTTCAAAAACTTTCAGCGACTTGAAGGTTACCAACATTTTGCCGCTGAGAGGTGGGGC
 
. : . : . : . : . : . :
rJMSF024O07+ GACACCAAAATTTGCGCAAAGAACTC
rJMFF043G17+ CACACCCAAATTCTCTCAAAGAACTCAGCTGGTTACTGAGAACTACCAAGTGGTCTGACA
rJMSF022O10+ CACACCCAAATTCTCTCAAAGAACTCAGCTGGTTACTGAGAACTACCAAGTGGTCTGACA
                      ____________________________________________________________
consensus CACACCCAAATTCTCTCAAAGAACTCAGCTGGTTACTGAGAACTACCAAGTGGTCTGACA
 
. : . : . : . : . : . :
rJMFF043G17+ ATACTCAAACAGAAAGATGTGTAGCAATTAGAAATTGTTCAGTGTTTGAAATGCAAAAAA
rJMSF022O10+ ATACTCAAACAGAAAGATGTGTAGCAATTAGAAATTGTTCAGTGTTTGAAATGCAAAAAA
                      ____________________________________________________________
consensus ATACTCAAACAGAAAGATGTGTAGCAATTAGAAATTGTTCAGTGTTTGAAATGCAAAAAA
 
. : . : . : . : . : . :
rJMFF043G17+ AGTTCATCCTCTTTAACCGTTTTGTTTACCAGTGTGGAATTTCAAGACTGAGTACTGCAT
rJMSF022O10+ AGTTCATCCTCTTTAACCGTTTTGTTTACCAGTGTGGAATTTCAAGACTGAGTACTGCAT
                      ____________________________________________________________
consensus AGTTCATCCTCTTTAACCGTTTTGTTTACCAGTGTGGAATTTCAAGACTGAGTACTGCAT
 
. : . : . : . : . : . :
rJMFF043G17+ GTATATGGTGGATGGTGTTGGACATGTTCTAAAATGTGCACTAATGTTGTACTCTAATTT
rJMSF022O10+ GTATATGGTGGATGGTGTTGGACATGTTCTAAAATGTGCACTAATGTTGTACTCTAATTT
                      ____________________________________________________________
consensus GTATATGGTGGATGGTGTTGGACATGTTCTAAAATGTGCACTAATGTTGTACTCTAATTT
 
. : . : . : . : . : . :
rJMFF043G17+ CTTTAGTCGCGGTTTTCCTCCTTGAACAACCAGATTATTATATGAAGAGGGTTGTGTGTT
rJMSF022O10+ CTTTAGTCGCGGTTTTCCTCCTTGAACAA-CAGATTATTATATGAAGA-GGTTGTGTGTT
                      ____________________________________________________________
consensus CTTTAGTCGCGGTTTTCCTCCTTGAACAACCAGATTATTATATGAAGAGGGTTGTGTGTT
 
. : . : . : . : . : . :
rJMFF043G17+ TTTCTCTAT
rJMSF022O10+ TTTCTCTATAAATGCTTTACATTCTAATGCACTGTAATATGCCAATCCTTATACTATGGA
                      ____________________________________________________________
consensus TTTCTCTATAAATGCTTTACATTCTAATGCACTGTAATATGCCAATCCTTATACTATGGA
 
. : . : . : . : . : . :
rJMSF022O10+ TCCCAGTTTATAGTGCACTGTGGATCCTGGTACATGTGGATGTGTTTTATTTTGTGAGTT
                      ____________________________________________________________
consensus TCCCAGTTTATAGTGCACTGTGGATCCTGGTACATGTGGATGTGTTTTATTTTGTGAGTT
 
. : . : . : . : . : . :
rJMSF022O10+ TTCGTGTCTTTTGTTGTTAAATTATGTACTTTAAGTGTATGAATTCTGACCAAAACAAAT
                      ____________________________________________________________
consensus TTCGTGTCTTTTGTTGTTAAATTATGTACTTTAAGTGTATGAATTCTGACCAAAACAAAT