Previous Contig 012272:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFS047E01Sequence510012272 (2)gb:AK176239_18182272e-31Arabidopsis thaliana mRNA, complete cds, clone: RAFL23-12-N11.
JMSF022M18Sequence626000514 (4)782012272 (2)gb:AK176239_18182271e-78Arabidopsis thaliana mRNA, complete cds, clone: RAFL23-12-N11.

Alignment

This contig is upended


. : . : . : . : . : . :
JMFS047E01+ CTCTCTAAAAAATAAATT
rJMSF022M18- AATT
                      ____________________________________________________________
consensus CTCTCTAAAAAATAAATT
 
. : . : . : . : . : . :
JMFS047E01+ CTTTCTAAAAATAAATTTCTCCTCTCTCCAAATCATCATCTCTCTCTTCTTTGTCATCCA
rJMSF022M18- CTTTCT-AAAATAAATTTCTCCTCTCTCC-AATCATCATCTCTCTCTTCTTTGTCATCCA
                      ____________________________________________________________
consensus CTTTCTAAAAATAAATTTCTCCTCTCTCCAAATCATCATCTCTCTCTTCTTTGTCATCCA
 
. : . : . : . : . : . :
JMFS047E01+ AAAAAACTAGTGTGGATGCTCTAAAGCAAGCAGTATAGTGTACCAAAAATGTACCTCAAC
rJMSF022M18- AAAAAACTAGTGTGGATGCTCTAAAGCAAGCAGTATAGTGTACCAAAAATGTACCTCAAC
                      ____________________________________________________________
consensus AAAAAACTAGTGTGGATGCTCTAAAGCAAGCAGTATAGTGTACCAAAAATGTACCTCAAC
 
. : . : . : . : . : . :
JMFS047E01+ TAAACTTAACAAAATTTTGCTATTACATATATAAATAAATATAATCTCATCAGCAGCGCT
rJMSF022M18- TAAACTTAACAAAATTTTGCTATTACATATATAAATAAATATAATCTCATCAGCAGCGCT
                      ____________________________________________________________
consensus TAAACTTAACAAAATTTTGCTATTACATATATAAATAAATATAATCTCATCAGCAGCGCT
 
. : . : . : . : . : . :
JMFS047E01+ CACATTAGTACTCCTTCAACATTGTTAATGGCCTTCTTGGCAATCTTGAATTTACCTGCT
rJMSF022M18- CACATTAGTACTCCTTCAACATTGTTAATGGCCTTCTTGGCAATCTTGAATTTACCTGCT
                      ____________________________________________________________
consensus CACATTAGTACTCCTTCAACATTGTTAATGGCCTTCTTGGCAATCTTGAATTTACCTGCT
 
. : . : . : . : . : . :
JMFS047E01+ AGAGACTTGTTACCATTTGCAACATATTCTCGTATAAAGATGACAATCCCGTTACAAAGG
rJMSF022M18- AGAGACTTGTTACCATTTGCAACATATTCTCGTATAAAGATGACAATCCCGTTACAAAGG
                      ____________________________________________________________
consensus AGAGACTTGTTACCATTTGCAACATATTCTCGTATAAAGATGACAATCCCGTTACAAAGG
 
. : . : . : . : . : . :
JMFS047E01+ GACTCATGCTCTGGCAAAGCAATTCGAGTAAAAATGTTCCATACTAGTTTATCTGGGAAC
rJMSF022M18- GACTCATGCTCTGGCAAAGCAATTCGAGTAAAAATGTTCCATACTAGTTTATCTGGGAAC
                      ____________________________________________________________
consensus GACTCATGCTCTGGCAAAGCAATTCGAGTAAAAATGTTCCATACTAGTTTATCTGGGAAC
 
. : . : . : . : . : . :
JMFS047E01+ TCAAAGATAGCTTCGAAAAGCATACGGAAATGCATAATCCTTTTTGGAGTTAATTGTGTG
rJMSF022M18- TCAAAGATAGCTTCGAAAAGCATACGGAAATGCATAATCCTTTTTGGAGTTAATTGTGTG
                      ____________________________________________________________
consensus TCAAAGATAGCTTCGAAAAGCATACGGAAATGCATAATCCTTTTTGGAGTTAATTGTGTG
 
. : . : . : . : . : . :
JMFS047E01+ ACATCACCTAGATCAACCACCTTTAAGACCGAAAGGGAAAGAGTATAAGATGCGAGCATC
rJMSF022M18- ACATCACCTAGATCAACCACCTTTAAGACCGAAAGGGAAAGAGTATAAGATGCGAGCATC
                      ____________________________________________________________
consensus ACATCACCTAGATCAACCACCTTTAAGACCGAAAGGGAAAGAGTATAAGATGCGAGCATC
 
. : . : . : . : . : . :
JMFS047E01+ TCTGCAATGAAT
rJMSF022M18- TCTGCAATGAATTTTGAGAGGTGCATTGATCTCATCAGTTCCATCGATTCCACTTCCTTG
                      ____________________________________________________________
consensus TCTGCAATGAATTTTGAGAGGTGCATTGATCTCATCAGTTCCATCGATTCCACTTCCTTG
 
. : . : . : . : . : . :
rJMSF022M18- AAATGGTCCCAAAGGCAATACTGCAGAGTAAACTTATGGTTCTTATCGTGGCCGCATAAC
                      ____________________________________________________________
consensus AAATGGTCCCAAAGGCAATACTGCAGAGTAAACTTATGGTTCTTATCGTGGCCGCATAAC
 
. : . : . : . : . : . :
rJMSF022M18- TTAGATGCTAGTGCACAATAATACTTATTAAATACTTTCTCCTGTAAGCAGCATTCTAAC
                      ____________________________________________________________
consensus TTAGATGCTAGTGCACAATAATACTTATTAAATACTTTCTCCTGTAAGCAGCATTCTAAC
 
. : . : . : . : . : . :
rJMSF022M18- AGAACTCGCATTATCTCCCTATCCTGCTTCCCAGGCAAGTCCAATCTTAGAAGCTTCTCA
                      ____________________________________________________________
consensus AGAACTCGCATTATCTCCCTATCCTGCTTCCCAGGCAAGTCCAATCTTAGAAGCTTCTCA
 
. : . : . : . : . : . :
rJMSF022M18- AATGCATCAATGTAGTCCTCACCGCTCATATTACACAGAAAATTGCTCTCCTCGCATCTG
                      ____________________________________________________________
consensus AATGCATCAATGTAGTCCTCACCGCTCATATTACACAGAAAATTGCTCTCCTCGCATCTG