Previous Contig 012264:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMSF004F15Sequence245004600 (4)350012264 (2)gb:AF083555_17668941e-25Arabidopsis thaliana magnesium-chelatase subunit CHLD precursor, mRNA, nuclear g
JMSF022J17Sequence694004600 (4)gb:A83552_14509859e-68Sequence 1 from Patent WO9849330.796012264 (2)gb:A83552_14509853e-94Sequence 1 from Patent WO9849330.

Alignment

This contig is upended


. : . : . : . : . : . :
rJMSF022J17+ GNCATTCAAAAAAGTA
                      ____________________________________________________________
consensus GNCATTCAAAAAAGTA
 
. : . : . : . : . : . :
rJMSF022J17+ GGAAAGTTTTTGTAGAGAAAACTGACATGAGAGCCAAAAGAATGGCACGCAAAGCGGGAG
                      ____________________________________________________________
consensus GGAAAGTTTTTGTAGAGAAAACTGACATGAGAGCCAAAAGAATGGCACGCAAAGCGGGAG
 
. : . : . : . : . : . :
rJMSF022J17+ CCTTGGTGATATTTGTAGTTGATGCTAGTGGAAGTATGGCATTAAATAGGATGCAGAATG
                      ____________________________________________________________
consensus CCTTGGTGATATTTGTAGTTGATGCTAGTGGAAGTATGGCATTAAATAGGATGCAGAATG
 
. : . : . : . : . : . :
rJMSF022J17+ CCAAGGGAGCAGCATTGAAGCTACTTGCAGAAAGTTATACAAGTAGAGATCAGGTTTCCA
                      ____________________________________________________________
consensus CCAAGGGAGCAGCATTGAAGCTACTTGCAGAAAGTTATACAAGTAGAGATCAGGTTTCCA
 
. : . : . : . : . : . :
rJMSF022J17+ TTATTCCTTTCCGTGGAGATTCTGCAGAAGTTCTGTTGCCTCCTTCAAGGTCAATCTCAA
                      ____________________________________________________________
consensus TTATTCCTTTCCGTGGAGATTCTGCAGAAGTTCTGTTGCCTCCTTCAAGGTCAATCTCAA
 
. : . : . : . : . : . :
rJMSF022J17+ TGGCAAGAAAGCGTCTTGAGAGACTTCCCTGTGGTGGGGGTTCTCCGCTTGCTCATGGAC
                      ____________________________________________________________
consensus TGGCAAGAAAGCGTCTTGAGAGACTTCCCTGTGGTGGGGGTTCTCCGCTTGCTCATGGAC
 
. : . : . : . : . : . :
rJMSF022J17+ TAACTACGGCAGTTAGAGTTGGGATGAATGCAGAGAAGAGTGGTGATGTTGGACGCATAA
                      ____________________________________________________________
consensus TAACTACGGCAGTTAGAGTTGGGATGAATGCAGAGAAGAGTGGTGATGTTGGACGCATAA
 
. : . : . : . : . : . :
rJMSF004F15+ CCTG
rJMSF022J17+ TGATCGTTGCAATTACTGATGGTAGAGCAAACATATCACTAAAAAGATCTACTGATCCTG
                      ____________________________________________________________
consensus TGATCGTTGCAATTACTGATGGTAGAGCAAACATATCACTAAAAAGATCTACTGATCCTG
 
. : . : . : . : . : . :
rJMSF004F15+ AAGCAGCAGCCTCTTCTGATGCACCCAGACCCTCTGCTCAAGAGCTGAAGGATGAAATAC
rJMSF022J17+ AAGCAGCAGCCTCTTCTGATGCACCCAGACCCTCTGCTCAAGAGCTGAAGGATGAAATAC
                      ____________________________________________________________
consensus AAGCAGCAGCCTCTTCTGATGCACCCAGACCCTCTGCTCAAGAGCTGAAGGATGAAATAC
 
. : . : . : . : . : . :
rJMSF004F15+ TTGAGGTAGCTGGTAAAATATACAAAGCGGGAATGTCCCTCCTTGTTATTGATACCGAGA
rJMSF022J17+ TTGAGGTAGCTGGTAAAATATACAAAGCGGGAATGTCCCTCCTTGTTATTGATACCGAGA
                      ____________________________________________________________
consensus TTGAGGTAGCTGGTAAAATATACAAAGCGGGAATGTCCCTCCTTGTTATTGATACCGAGA
 
. : . : . : . : . : . :
rJMSF004F15+ ACAAGTTTGTGTCCACTGGCTTTGCAAAAGAAATTGCAAAAATTGCTCAAGGGAAGTATT
rJMSF022J17+ ACAAGTTTGTGTCCACTGGCTTTGCAAAAGAAATTGCAAAAATTGCTCAAGGGAAGTATT
                      ____________________________________________________________
consensus ACAAGTTTGTGTCCACTGGCTTTGCAAAAGAAATTGCAAAAATTGCTCAAGGGAAGTATT
 
. : . : . : . : . : . :
rJMSF004F15+ ATTATTTGCCAAATGCTTCAGATGCTGTTATCTCTGCAACAACAAAGGATGCATTGGCTG
rJMSF022J17+ ATTATTTGCCAAATGCTTCAGATGCTGTTATCTCTGCAACAACAAAGGATGCATTGGCTG
                      ____________________________________________________________
consensus ATTATTTGCCAAATGCTTCAGATGCTGTTATCTCTGCAACAACAAAGGATGCATTGGCTG
 
. : . : . : . : . : . :
rJMSF004F15+ CTCTAAAGAGCTCATAAACCTTAAAACTACTTGATTCTTAATTGTAGAGTGAGTGAGGCT
rJMSF022J17+ CTCTAAAGAGCTCATAAACCTTAAAACTACTTGATTCTTAATTGTAGAGTGAGTGAGGCT
                      ____________________________________________________________
consensus CTCTAAAGAGCTCATAAACCTTAAAACTACTTGATTCTTAATTGTAGAGTGAGTGAGGCT
 
. : . : . : . : . : . :
rJMSF004F15+ GTTTGATAGTATTATTTGAGAGGAAGTACATCCTAACCAAAAAT
rJMSF022J17+ GTTTGATAGTATTATTTGAGAGGAAGTACATCCTAACCAAAAATTGTATTTTGCGGTTTT
                      ____________________________________________________________
consensus GTTTGATAGTATTATTTGAGAGGAAGTACATCCTAACCAAAAATTGTATTTTGCGGTTTT