Previous Contig 012262:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMSF007F24Sequence388012262 (6)797012262 (6)
JMSF013L14Sequence259012262 (6)716012262 (6)
JMSF022J13Sequence666012262 (6)768012262 (6)

Alignment

This contig is upended


. : . : . : . : . : . :
JMSF013L14- GG
JMSF007F24- GG
JMSF022J13- GG
                      ____________________________________________________________
consensus GG
 
. : . : . : . : . : . :
JMSF013L14- ATTCGTCTTCTCTCTACTAACACCGCCAATTCGTTTTCTCTCTACCTCCCTACTTTCTCT
JMSF007F24- ATTCGTCTTCTCTCTACTAACACCGCCAATTCGTTTTCTCTCTACCTCCCTACTTTCTCT
JMSF022J13- ATTCGTCTTCTCTCTACTAACACCGCCAATTCGTTTTCTCTCTACCTCCCTACTTTCTCT
                      ____________________________________________________________
consensus ATTCGTCTTCTCTCTACTAACACCGCCAATTCGTTTTCTCTCTACCTCCCTACTTTCTCT
 
. : . : . : . : . : . :
JMSF013L14- CTGGCGATGTCCGAAACTCCGAATCACAGTGTTCTACCCTTGCCGTTCTTGGTCTCTACT
JMSF007F24- CTGGCGATGTCCGAAACTCCGAATCACAGTGTTCTACCCTTGCCGTTCTTGGTCTCTACT
JMSF022J13- CTGGCGATGTCCGAAACTCCGAATCACAGTGTTCTACCCTTGCCGTTCTTGGTCTCTACT
                      ____________________________________________________________
consensus CTGGCGATGTCCGAAACTCCGAATCACAGTGTTCTACCCTTGCCGTTCTTGGTCTCTACT
 
. : . : . : . : . : . :
JMSF013L14- TTCCGTTTTGATCCTGTGTTTTTCTACACCCAATCGCACATATAAACAGTTGGTGTTGTG
JMSF007F24- TTCCGTTTTGATCCTGTGTTTTTCTACACCCAATCGCACATATAAACAGTTGGTGTTGTG
JMSF022J13- TTCCGTTTTGATCCTGTGTTTTTCTACACCCAATCGCACATATAAACAGTTGGTGTTGTG
                      ____________________________________________________________
consensus TTCCGTTTTGATCCTGTGTTTTTCTACACCCAATCGCACATATAAACAGTTGGTGTTGTG
 
. : . : . : . : . : . :
JMSF013L14- TAAATCTTACGTCTAAATTAGTATTTTAGGGTTTATGTGTTTTTCGTTAGCAGATCGGAA
JMSF007F24- TAAATCTTACGTCTAAATTAGTATTTTAGGGTTTATGTGTTTTTCGTTAGCAGATCGGAA
JMSF022J13- TAAATCTTACGTCTAAATTAGTATTTTAGGGTTTATGTGTTTTTCGTTAGCAGATCGGAA
                      ____________________________________________________________
consensus TAAATCTTACGTCTAAATTAGTATTTTAGGGTTTATGTGTTTTTCGTTAGCAGATCGGAA
 
. : . : . : . : . : . :
JMSF013L14- CTTCTACATGATGTTAA
JMSF007F24- CTTCTACATGATGTTAATGTTAAGAGTTGGCGAAATCAGAGGAAGGATGTTGAATAAGCT
JMSF022J13- CTTCTACATGATGTTAATGTTAAGAGTTGGCGAAATCAGAGGAAGGATGTTGAATAAGCT
                      ____________________________________________________________
consensus CTTCTACATGATGTTAATGTTAAGAGTTGGCGAAATCAGAGGAAGGATGTTGAATAAGCT
 
. : . : . : . : . : . :
JMSF007F24- AAGTAACCGATCCCTATATCTATTTCTCTATATAATTCATTTTTAATTTCAACACCTATC
JMSF022J13- AAGTAACCGATCCCTATATCTATTTCTCTATATAATTCATTTTTAATTTCAACACCTATC
                      ____________________________________________________________
consensus AAGTAACCGATCCCTATATCTATTTCTCTATATAATTCATTTTTAATTTCAACACCTATC
 
. : . : . : . : . : . :
JMSF007F24- TACAATTTAGTCTAAAAATACTGGTA
JMSF022J13- TACAATTTAGTCTAAAAATACTGGTAGATGATTTCATCCTATGATTGACCATATTAGGAT
                      ____________________________________________________________
consensus TACAATTTAGTCTAAAAATACTGGTAGATGATTTCATCCTATGATTGACCATATTAGGAT
 
. : . : . : . : . : . :
JMSF022J13- TTTTTTTTGATAAATTGTTAACATGCAAGCGAGAGAACAACAATGGTAAAAAAAAATTTG
                      ____________________________________________________________
consensus TTTTTTTTGATAAATTGTTAACATGCAAGCGAGAGAACAACAATGGTAAAAAAAAATTTG
 
. : . : . : . : . : . :
JMSF022J13- TACACATGCATCGATTTTTCTATCCCTTTACTCCGTTCATTCATTTTTCTGTATGTTTAC
rJMSF007F24+ CTCCGTTCATTCATTTTTCGGTANGTTTAC
                      ____________________________________________________________
consensus TACACATGCATCGATTTTTCTATCCCTTTACTCCGTTCATTCATTTTTCTGTATGTTTAC
 
. : . : . : . : . : . :
JMSF022J13- TTTTATATTTCTGTATGTTAGAGTAATAGTCTATTATTCTTATCATTCACTATTTGAATA
rJMSF007F24+ TTTTATATTTCNGTATGTTAGAGTAATAGTCTATTATTCTTATCATNCACTATTTGAATA
rJMSF013L14+ ATTTGAATA
rJMSF022J13+ GTATGTTAGAGTAATAGTCTATTATTCTTATCATTCACTATTTGAATA
                      ____________________________________________________________
consensus TTTTATATTTCTGTATGTTAGAGTAATAGTCTATTATTCTTATCATTCACTATTTGAATA
 
. : . : . : . : . : . :
JMSF022J13- TAATTAGGGTTTTTCTAACTACAGCAGAGTGAATATTTGNGAACTCAATCTAAAGTTTCC
rJMSF007F24+ TAATTAGGGTTTTTCTAACTACAGCAGAGTGAATATTTGTGAACTCAATCTAAAGTTTCC
rJMSF013L14+ TAATTAGGGTTTTTCTAACTACAGCAGAGTGAATATTTGTGAACTCAATCTAAAGTTTCC
rJMSF022J13+ TAATTAGGGTTTTTCTAACTACAGCAGAGTGAATATTTGTGAACTCAATCTAAAGTTTCC
                      ____________________________________________________________
consensus TAATTAGGGTTTTTCTAACTACAGCAGAGTGAATATTTGTGAACTCAATCTAAAGTTTCC
 
. : . : . : . : . : . :
JMSF022J13- TCTG
rJMSF007F24+ TCTGTAAAAAATATATATCTGCGGAGTATTATATTTGAAATGATTTTTTATGCTAACAGA
rJMSF013L14+ TCTGTAAAAAATATATATCTGCGGAGTATTATATTTGAAATGATTTTTTATGCTAACAGA
rJMSF022J13+ TCTGTAAAAAATATATATCTGCGGAGTATTATATTTGAAATGATTTTTTATGCTAACAGA
                      ____________________________________________________________
consensus TCTGTAAAAAATATATATCTGCGGAGTATTATATTTGAAATGATTTTTTATGCTAACAGA
 
. : . : . : . : . : . :
rJMSF007F24+ TTTAGAAATGATTATGCTGACAAATTATTAGCTCTGGAATGAAATTGCAAATGAACATAA
rJMSF013L14+ TTTAGAAATGATTATGCTGACAAATTATTAGCTCTGGAATGAAATTGCAAATGAACATAA
rJMSF022J13+ TTTAGAAATGATTATGCTGACAAATTATTAGCTCTGGAATGAAATTGCAAATGAACATAA
                      ____________________________________________________________
consensus TTTAGAAATGATTATGCTGACAAATTATTAGCTCTGGAATGAAATTGCAAATGAACATAA
 
. : . : . : . : . : . :
rJMSF007F24+ AACTAATTGATTCAAGTTTTTCATTTCAGATTCAGAAAAGGAAGGCTATTACCATGGTAA
rJMSF013L14+ AACTAATTGATTCAAGTTTTTCATTTCAGATTCAGAAAAGGAAGGCTATTACCATGGTAA
rJMSF022J13+ AACTAATTGATTCAAGTTTTTCATTTCAGATTCAGAAAAGGAAGGCTATTACCATGGTAA
                      ____________________________________________________________
consensus AACTAATTGATTCAAGTTTTTCATTTCAGATTCAGAAAAGGAAGGCTATTACCATGGTAA
 
. : . : . : . : . : . :
rJMSF007F24+ GAGGCATATGTAGTGCATAGAAGAAGGCATGATCAAGAAATATGCTTCTGAGGTATTCAA
rJMSF013L14+ GAGGCATATGTAGTGCATAGAAGAAGGCATGATCAAGAAATATGCTTCTGAGGTATTCAA
rJMSF022J13+ GAGGCATATGTAGTGCATAGAAGAAGGCATGATCAAGAAATATGCTTCTGAGGTATTCAA
                      ____________________________________________________________
consensus GAGGCATATGTAGTGCATAGAAGAAGGCATGATCAAGAAATATGCTTCTGAGGTATTCAA
 
. : . : . : . : . : . :
rJMSF007F24+ CCCAACATCAAACAATTTGAAAGTGTCTGAGAAGGACTTGCTAATATTGCTGGATGCAGT
rJMSF013L14+ CCCAACATCAAACAATTTGAAAGTGTCTGAGAAGGACTTGCTAATATTGCTGGATGCAGT
rJMSF022J13+ CCCAACATCAAACAATTTGAAAGTGTCTGAGAAGGACTTGCTAATATTGCTGGATGCAGT
                      ____________________________________________________________
consensus CCCAACATCAAACAATTTGAAAGTGTCTGAGAAGGACTTGCTAATATTGCTGGATGCAGT
 
. : . : . : . : . : . :
rJMSF007F24+ TGGACAAAGAGGTTTTTTCCAATGTAAAGGGGAGCCATTCTCAGCCATTGATTGCAAAGA
rJMSF013L14+ TGGACAAAGAGGTTTTTTCCAATGTAAAGGGGAGCCATTCTCAGCCATTGATTGCAAAGA
rJMSF022J13+ TGGACAAAGAGGTTTTTTCCAATGTAAAGGGGAGCCATTCTCAGCCATTGATTGCAAAGA
                      ____________________________________________________________
consensus TGGACAAAGAGGTTTTTTCCAATGTAAAGGGGAGCCATTCTCAGCCATTGATTGCAAAGA
 
. : . : . : . : . : . :
rJMSF007F24+ ATGGCTGGAAACACGAAAGGGTTAAACGAAGATGGGTGGATTGTTAGTATGCTGAATTTA
rJMSF013L14+ ATGGCTGGAAACACGAAAGGGTTAAACGAAGATGGGTGGATTGTTAGTATGCTGAATTTA
rJMSF022J13+ ATGGCTGGAAACACGAAAGGGTTAAACGAAGATGGGTGGATTGTTAGTATGCTGAATTTA
                      ____________________________________________________________
consensus ATGGCTGGAAACACGAAAGGGTTAAACGAAGATGGGTGGATTGTTAGTATGCTGAATTTA
 
. : . : . : . : . : . :
rJMSF007F24+ TAGAACACCTTTGAAGGTTGAAGAGTTCGACATGTTGCTGGATTGAAGGCTGTAGAGTTC
rJMSF013L14+ TAGAACACCTTTGAAGGTTGAAGAGTTCGACATGTTGCTGGATTGAAGGCTGTAGAGTTC
rJMSF022J13+ TAGAACACCTTTGAAGGTTGAAGAGTTCGACATGTTGCTGGATTGAAGGCTGTAGAGTTC
                      ____________________________________________________________
consensus TAGAACACCTTTGAAGGTTGAAGAGTTCGACATGTTGCTGGATTGAAGGCTGTAGAGTTC
 
. : . : . : . : . : . :
rJMSF007F24+ CAAAAAAACGCTGTCATTATTGAAGAGCAATAATAGCTGTGCCCCGGAATCTGAAACGCC
rJMSF013L14+ CAAAAAAACGCTGTCATTATTGAAGAGCAATAATAGCTGTGCCCCGGAATCTGAAACGCC
rJMSF022J13+ CAAAAAAACGCTGTCATTATTGAAGAGCAATAATAGCTGTGCCCCGGAATCTGAAACGCC
                      ____________________________________________________________
consensus CAAAAAAACGCTGTCATTATTGAAGAGCAATAATAGCTGTGCCCCGGAATCTGAAACGCC
 
. : . : . : . : . : . :
rJMSF007F24+ ACAAAGTAGAAAGCTGCTTTTGAATTGATTTGAATCAATCTTAATTTATTTCTTTAACCA
rJMSF013L14+ ACAAAGTAGAAAGCTGCTTTTGAATTGATTTGAATCAATCTTAATTTATTTCTTTAA-CA
rJMSF022J13+ ACAAAGTAGAAAGCTGCTTTTGAATTGATTTGAATCAATCTTAATTTATTTCTTTAA-CA
                      ____________________________________________________________
consensus ACAAAGTAGAAAGCTGCTTTTGAATTGATTTGAATCAATCTTAATTTATTTCTTTAA-CA
 
. : . : . : . : . : . :
rJMSF007F24+ TGTGTATTTATTCGGAACAACTTCCCACAACTTGAGAGAACCAAAAC
rJMSF013L14+ TGTGTATTTATTCGGAACAACTTCCCACAACTTGAGAGAACCAAAAC
rJMSF022J13+ TGTGTATTTATTCGGAACAACTTCCCACAACTTGAGAGAACCAAAACTGGTGGCCAAGCA
                      ____________________________________________________________
consensus TGTGTATTTATTCGGAACAACTTCCCACAACTTGAGAGAACCAAAACTGGTGGCCAAGCA