Previous Contig 012261:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMSF022J11Sequence627012261 (2)pir|B84766|B847664e-58hypothetical protein At2g35240 [imported] - Arabidopsis thaliana>gb:AC004667_153665012261 (2)gb:AP002837_18230053e-71Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 6, BAC clone:OSJN

Alignment

This contig is upended


. : . : . : . : . : . :
JMSF022J11- GATCGGCCGTTCAATCTACACGCTCATGGCTGCAAC
                      ____________________________________________________________
consensus GATCGGCCGTTCAATCTACACGCTCATGGCTGCAAC
 
. : . : . : . : . : . :
JMSF022J11- TCTAAAGCTCGCAGAATCCCTCCGTCGCTCTCATCCCACCGCCGCTCGCTTCTACTCCAC
                      ____________________________________________________________
consensus TCTAAAGCTCGCAGAATCCCTCCGTCGCTCTCATCCCACCGCCGCTCGCTTCTACTCCAC
 
. : . : . : . : . : . :
JMSF022J11- TGCTCGCCTTCTCTCATCGGCCTCTTCATCGCCGTCGATTACTCAGCAGCCGGATATCCC
                      ____________________________________________________________
consensus TGCTCGCCTTCTCTCATCGGCCTCTTCATCGCCGTCGATTACTCAGCAGCCGGATATCCC
 
. : . : . : . : . : . :
JMSF022J11- CGCCGTGCGCTGCTCCCCGCAACCCTCGTTTCTCATTTCACACTCCCCTCTACCCTCCTC
rJMSF022J11+ TCCTC
                      ____________________________________________________________
consensus CGCCGTGCGCTGCTCCCCGCAACCCTCGTTTCTCATTTCACACTCCCCTCTACCCTCCTC
 
. : . : . : . : . : . :
JMSF022J11- CAGCCCATATGGGATTAACCCCGCCCGCTTCAACCCGGCTCGGCTCCGCGTCAACCGATC
rJMSF022J11+ CAGCCCATATGGGATTAACCCCGCCCGCTTCAACCCGGCTCGGCTCCGCGTCAACCGATC
                      ____________________________________________________________
consensus CAGCCCATATGGGATTAACCCCGCCCGCTTCAACCCGGCTCGGCTCCGCGTCAACCGATC
 
. : . : . : . : . : . :
JMSF022J11- CGGAAATCCGCCGTACAATCCCGGGTCCAGCGACCGTCCTCCCACCGAGATGGCTCCGCT
rJMSF022J11+ CGGAAATCCGCCGTACAATCCCGGGTCCAGCGACCGTCCTCCCACCGAGATGGCTCCGCT
                      ____________________________________________________________
consensus CGGAAATCCGCCGTACAATCCCGGGTCCAGCGACCGTCCTCCCACCGAGATGGCTCCGCT
 
. : . : . : . : . : . :
JMSF022J11- TTTCCCCGGTTGCGATTACGAGCACTGGCTGATCGTCATGGATAAGCCCGGCGGTGAAGG
rJMSF022J11+ TTTCCCCGGTTGCGATTACGAGCACTGGCTGATCGTCATGGATAAGCCCGGCGGTGAAGG
                      ____________________________________________________________
consensus TTTCCCCGGTTGCGATTACGAGCACTGGCTGATCGTCATGGATAAGCCCGGCGGTGAAGG
 
. : . : . : . : . : . :
JMSF022J11- CGCCGCCAAACAGCAAATGATCGATTGCTACATTCAAACTCTTGCTAAAGTCCTAGGAAG
rJMSF022J11+ CGCCGCCAAACAGCAAATGATCGATTGCTACATTCAAACTCTTGCTAAAGTCCTAGGAAG
                      ____________________________________________________________
consensus CGCCGCCAAACAGCAAATGATCGATTGCTACATTCAAACTCTTGCTAAAGTCCTAGGAAG
 
. : . : . : . : . : . :
JMSF022J11- TGAAGAGGAGGCTAAGAAGAAGATTTACAATGTTTCTTGTGAGAGGTACTTCGGTTTTGG
rJMSF022J11+ TGAAGAGGAGGCTAAGAAGAAGATTTACAATGTTTCTTGTGAGAGGTACTTCGGTTTTGG
                      ____________________________________________________________
consensus TGAAGAGGAGGCTAAGAAGAAGATTTACAATGTTTCTTGTGAGAGGTACTTCGGTTTTGG
 
. : . : . : . : . : . :
JMSF022J11- CTGTGAAGTGGACGAAGAGACTGCAAATAAGATGGAAGGTTTGCCTGGAGTTTTGTTTGT
rJMSF022J11+ CTGTGAAGTGGACGAAGAGACTGCAAATAAGATGGAAGGTTTGCCTGGAGTTTTGTTTGT
                      ____________________________________________________________
consensus CTGTGAAGTGGACGAAGAGACTGCAAATAAGATGGAAGGTTTGCCTGGAGTTTTGTTTGT
 
. : . : . : . : . : . :
JMSF022J11- GCTGCCTGATTCATATGTTGATCCTGAATACAAGGACTATGGAGCTGAATT
rJMSF022J11+ GCTGCCTGATTCATATGTTGATCCTGAATACAAGGACTATGGAGCTGAATTGTTTGTCAA
                      ____________________________________________________________
consensus GCTGCCTGATTCATATGTTGATCCTGAATACAAGGACTATGGAGCTGAATTGTTTGTCAA
 
. : . : . : . : . : . :
rJMSF022J11+ TGGGGAGATAGTTCAACGATCACCTGAACGACAGAGGCGAGTGGAGCCTGTTCCTCAACG
                      ____________________________________________________________
consensus TGGGGAGATAGTTCAACGATCACCTGAACGACAGAGGCGAGTGGAGCCTGTTCCTCAACG
 
. : . : . : . : . : . :
rJMSF022J11+ TGATAGAGTACGACCCAACACGCGATACAACAGGCGCCGAGACATGAGATGAAAATTTTT
                      ____________________________________________________________
consensus TGATAGAGTACGACCCAACACGCGATACAACAGGCGCCGAGACATGAGATGAAAATTTTT
 
. : . : . : . : . : . :
rJMSF022J11+ AATATAATGTCTTAGATGGCTTAATTATGTATTCATGCAGTGTTTGAGACCACAATGGTT
                      ____________________________________________________________
consensus AATATAATGTCTTAGATGGCTTAATTATGTATTCATGCAGTGTTTGAGACCACAATGGTT
 
. : . : . : . : . : . :
rJMSF022J11+ GTGAACAGAACTCTCTTTCTTGAATCAGACTCTGTCAGTTTATGTAATGTGTTTAGGTAT
                      ____________________________________________________________
consensus GTGAACAGAACTCTCTTTCTTGAATCAGACTCTGTCAGTTTATGTAATGTGTTTAGGTAT