Previous Contig 012258:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF003C18Sequence645012258 (5)gb:ATAC012328_15434099e-16Arabidopsis thaliana chromosome III BAC T17B22 genomic sequence, complete sequen
JMFF037A21Sequence509007887 (7)gb:ATAC012328_15434095e-07Arabidopsis thaliana chromosome III BAC T17B22 genomic sequence, complete sequen743012258 (5)gb:ATAC012328_15434094e-37Arabidopsis thaliana chromosome III BAC T17B22 genomic sequence, complete sequen
JMFS114D12Sequence561012258 (5)gb:ATAC012328_15434094e-48Arabidopsis thaliana chromosome III BAC T17B22 genomic sequence, complete sequen
JMSF022H20Sequence653007887 (7)gb:ATAC012328_15434092e-20Arabidopsis thaliana chromosome III BAC T17B22 genomic sequence, complete sequen788012258 (5)gb:ATAC012328_15434095e-42Arabidopsis thaliana chromosome III BAC T17B22 genomic sequence, complete sequen
JMSF049B02Sequence679007887 (7)gb:ATAC012328_15434092e-20Arabidopsis thaliana chromosome III BAC T17B22 genomic sequence, complete sequen719012258 (5)gb:ATAC012328_15434097e-28Arabidopsis thaliana chromosome III BAC T17B22 genomic sequence, complete sequen

Alignment

This contig is upended


. : . : . : . : . : . :
JMFS114D12- GAGAACTAGATCAGGAGTGTGTATTAAC
                      ____________________________________________________________
consensus GAGAACTAGATCAGGAGTGTGTATTAAC
 
. : . : . : . : . : . :
JMFS114D12- TTCAGGAAAACTGTACAGTAGGGGAAGAAGAAAAATGGATAATGAAACAATTGCTGATGT
                      ____________________________________________________________
consensus TTCAGGAAAACTGTACAGTAGGGGAAGAAGAAAAATGGATAATGAAACAATTGCTGATGT
 
. : . : . : . : . : . :
JMFS114D12- AACTGAAGCACTAATCGGTGCATTTCTTAGTACGGCTGGAGAAATAGCAGCTCTATCATT
                      ____________________________________________________________
consensus AACTGAAGCACTAATCGGTGCATTTCTTAGTACGGCTGGAGAAATAGCAGCTCTATCATT
 
. : . : . : . : . : . :
JMFS114D12- TCTCAGGTGGCTCGGTCTAGATATTGATTTTATCGATGCGCCCATCGTTGGGAACTTTCC
                      ____________________________________________________________
consensus TCTCAGGTGGCTCGGTCTAGATATTGATTTTATCGATGCGCCCATCGTTGGGAACTTTCC
 
. : . : . : . : . : . :
JMFS114D12- CTTGAATGCAGAGCAGATGGTTAACGTCAAACGTTTGGAGTCTGATTCGTTGTTGAATTA
                      ____________________________________________________________
consensus CTTGAATGCAGAGCAGATGGTTAACGTCAAACGTTTGGAGTCTGATTCGTTGTTGAATTA
 
. : . : . : . : . : . :
JMFS114D12- TACATTTCGCGATCCTTCTCTGCTTGTTGAAGCATTGACTCATGGCTCTTACATTCCACA
                      ____________________________________________________________
consensus TACATTTCGCGATCCTTCTCTGCTTGTTGAAGCATTGACTCATGGCTCTTACATTCCACA
 
. : . : . : . : . : . :
JMFS114D12- TGGAACTCAATCTTACCAGCGTTTGGAGTTTCTCGGGGACGCTGTGCTAGATTATGCCGT
rJMSF022H20+ TATGCCGT
                      ____________________________________________________________
consensus TGGAACTCAATCTTACCAGCGTTTGGAGTTTCTCGGGGACGCTGTGCTAGATTATGCCGT
 
. : . : . : . : . : . :
JMFS114D12- TACCAGGCATTTCTATGATCAGTATCCCGGACTATCCCCGGGATGCTTAACCGAGCTGAG
rJMFF037A21+ ATGCTTAACCGAGCTGAG
rJMSF049B02+ ATGCTTAACCGAGCTGAG
rJMSF022H20+ TACCAGGCATTTCTATGATCAGTATCCCGGACTATTCCCGGGATGCTTAACCGAGCTGAG
                      ____________________________________________________________
consensus TACCAGGCATTTCTATGATCAGTATCCCGGACTATTCCCGGGATGCTTAACCGAGCTGAG
 
. : . : . : . : . : . :
JMFS114D12- GTCTGAATCAGTGAACAACGCCTGCTATGCTCTATCCTCGGTTAAGGCTGGGTTGCATAA
rJMFF037A21+ GTCTGAATCAGTGAACAACGCCTGCTATGCTCTATCCTCGGTTAAGGCTGGGTTGCATAA
rJMSF049B02+ GTCTGAATCAGTGAACAACGCCTGCTATGCTCTATCCTCGGTTAAGGCTGGGTTGCATAA
rJMSF022H20+ GTCTGAATCAGTGAACAACGCCTGCTATGCTCTATCCTCGGTTAAGGCTGGGTTGCATAA
                      ____________________________________________________________
consensus GTCTGAATCAGTGAACAACGCCTGCTATGCTCTATCCTCGGTTAAGGCTGGGTTGCATAA
 
. : . : . : . : . : . :
JMFS114D12- CTATATTCTTCACTCGTCCACTGCTCTTCGGAGCAGTATAGCTGATTTTGTTA
rJMFF037A21+ CTATATTCTTCACTCGTCCACTGCTCTTCGGAGCAGTATAGCTGATTTTGTTAAGAATAT
rJMSF049B02+ CTATATTCTTCACTCGTCCACTGCTCTTCGGAGCAGTATAGCTGATTTTGTTAAGAATAT
rJMSF022H20+ CTATATTCTTCACTCGTCCACTGCTCTTCGGAGCAGTATAGCTGATTTTGTTAAGAATAT
                      ____________________________________________________________
consensus CTATATTCTTCACTCGTCCACTGCTCTTCGGAGCAGTATAGCTGATTTTGTTAAGAATAT
 
. : . : . : . : . : . :
rJMFF037A21+ CGAGCAGTCATCAGCCTCATCAACATTTGGATGGGTGCTCAAGACAAGTTTCCCATGGGT
rJMSF049B02+ CGAGCAGTCATCAGCCTCATCAACATTTGGATGGGTGCTCAAGACAAGTTTCCCATG---
rJMFF003C18+ GGT
rJMSF022H20+ CGAGCAGTCATCAGCCTCATCAACATTTGGATGGGTGCTCAAGACAAGTTTCCCATGGGT
                      ____________________________________________________________
consensus CGAGCAGTCATCAGCCTCATCAACATTTGGATGGGTGCTCAAGACAAGTTTCCCATGGGT
 
. : . : . : . : . : . :
rJMFF037A21+ TCTTGCTGATATCATAGAATCTATAGCGGGGGCAATATATCTCGATTCGGGTTTGAGAAC
rJMSF049B02+ ----------------GAATCTATAGCGGGGGCAATATATCTCGATTCGGGTTTGAGAAC
rJMFF003C18+ TCTTGCTGATATCATAGAATCTATAGCGGGGGCAATATATCTCGATTCGGGTTTGAGAAC
rJMSF022H20+ TCTTGCTGATATCATAGAATCTATAGCGGGGGCAATATATCTCGATTCGGGTTTGAGAAC
                      ____________________________________________________________
consensus TCTTGCTGATATCATAGAATCTATAGCGGGGGCAATATATCTCGATTCGGGTTTGAGAAC
 
. : . : . : . : . : . :
rJMFF037A21+ AGACATAGTTTTTGAGAAAATAAGACCGGTTTTGGAGCCCATGGTTACACCCGAGTCCCT
rJMSF049B02+ AGACATAGTTTTTGAGAAAATAAGACCGGTTTTGGAGCCCATGGTTACACCCGAGTCCCT
rJMFF003C18+ AGACATAGTTTTTGAGAAAATAAGACCGGTTTTGGAGCCCATGGTTACACCCGAGTCCCT
rJMSF022H20+ AGACATAGTTTTTGAGAAAATAAGACCGGTTTTGGAGCCCATGGTTACACCCGAGTCCCT
                      ____________________________________________________________
consensus AGACATAGTTTTTGAGAAAATAAGACCGGTTTTGGAGCCCATGGTTACACCCGAGTCCCT
 
. : . : . : . : . : . :
rJMFF037A21+ GAGACTTAACCCCGTAAAAGAGCTGACCGAGCTATGCCAAAAGAGAAAGTACAGGATGAA
rJMSF049B02+ GAGACTTAACCCCGTAAAAGAGCTGACCGAGCTATGCCAAAAGAGAAAGTACAGGATGAA
rJMFF003C18+ GAGACTTAACCCCGTAAAAGAGCTGACCGAGCTATGCCAAAAGAGAAAGTACAGGATGAA
rJMSF022H20+ GAGACTTAACCCCGTAAAAGAGCTGACCGAGCTATGCCAAAAGAGAAAGTACAGGATGAA
                      ____________________________________________________________
consensus GAGACTTAACCCCGTAAAAGAGCTGACCGAGCTATGCCAAAAGAGAAAGTACAGGATGAA
 
. : . : . : . : . : . :
rJMFF037A21+ GGAGCCTGTTGTGGTTCACAAAGATGGCGAGGCATTTACGACGATTGAGGTCATGGCAAA
rJMSF049B02+ GGAGCCTGTTGTGGTTCACAAAGATGGCGAGGCATGTACGACGATTGAGGTCATGGCAAA
rJMFF003C18+ GGAGCCTGTTGTGGTTCACAAAGATGGCGAGGCATGTACGACGATTGAGGTCATGGCAAA
rJMSF022H20+ GGAGCCTGTTGTGGTTCACAAAGATGGCGAGGCATGTACGACGATTGAGGTCATGGCAAA
                      ____________________________________________________________
consensus GGAGCCTGTTGTGGTTCACAAAGATGGCGAGGCATGTACGACGATTGAGGTCATGGCAAA
 
. : . : . : . : . : . :
rJMFF037A21+ TGGCGGTGTTCGCAGTTGCTCGTCCTCTGCTCGCAATCGAAAGACTGCCAAGAGATTGGC
rJMSF049B02+ TGGCGGTGTTCGCAGTTGCTCGTCCTCTGCTCGCAATCGAAAGACTGCCAAGAGATTGGC
rJMFF003C18+ TGGCGGTGTTCGCAGTTGCTCGTCCTCTGCTCGCAATCGAAAGACTGCCAAGAGATTGGC
rJMSF022H20+ TGGCGGTGTTCGCAGTTGCTCGTCCTCTGCTCGCAATCGAAAGACTGCCAAGAGATTGGC
                      ____________________________________________________________
consensus TGGCGGTGTTCGCAGTTGCTCGTCCTCTGCTCGCAATCGAAAGACTGCCAAGAGATTGGC
 
. : . : . : . : . : . :
rJMFF037A21+ TTGCGAGAGAATGCTGGAGTTGCTGGAATCTGAAACCTGTTCCTGAGAGTTTATTTGATC
rJMSF049B02+ TTGCGAGAGAATGCTGGAGTTGCTGGAATCTGAAACCTGTTCCTGAGAGTTTATTTGATC
rJMFF003C18+ TTGCGAGAGAATGCTGGAGTTGCTGGAATCTGAAACCTGTTCCTGAGAGTTTATTTGATC
rJMSF022H20+ TTGCGAGAGAATGCTGGAGTTGCTGGAATCTGAAACCTGTTCCTGAGAGTTTATTTGATC
                      ____________________________________________________________
consensus TTGCGAGAGAATGCTGGAGTTGCTGGAATCTGAAACCTGTTCCTGAGAGTTTATTTGATC
 
. : . : . : . : . : . :
rJMFF037A21+ TAATCTTTATGATCAAGCTAAGGAGTAGCAATTCCTTCCTGGGAATTGTTGTTTTATCTT
rJMSF049B02+ TAATCTTTATGATCAAGCTAAGGAGTAGCAATTCCTTCCTGGGAATTGTTGTTTTATCTT
rJMFF003C18+ TAATCTTTATGATCAAGCTAAGGAGTAGCAATTCCTTCCTGGGAATTGTTGTTTTATCTT
rJMSF022H20+ TAATCTTTATGATCAAGCTAAGGAGTAGCAATTCCTTCCTGGGAATTGTTGTTTTATCTT
                      ____________________________________________________________
consensus TAATCTTTATGATCAAGCTAAGGAGTAGCAATTCCTTCCTGGGAATTGTTGTTTTATCTT
 
. : . : . : . : . : . :
rJMFF037A21+ TTGTAAATAGAATTCTGCAGAATCCTTTAATTTTCTAAGACTTTTAGGATGAGCCAAACA
rJMSF049B02+ TTGTAAATAGAATTCTGCAGAATCCTTTAATTTTCTAAGACTTTTAGGATGAGCCAAACA
rJMFF003C18+ TTGTAAATAGAATTCTGCAGAATCCTTTAATTTTCTAAGACTTTTAGGATGAGCCAAACA
rJMSF022H20+ TTGTAAATAGAATTCTGCAGAATCCTTTAATTTTCTAAGACTTTTAGGATGAGCCAAACA
                      ____________________________________________________________
consensus TTGTAAATAGAATTCTGCAGAATCCTTTAATTTTCTAAGACTTTTAGGATGAGCCAAACA
 
. : . : . : . : . : . :
rJMFF037A21+ GAAAAAAATGCACTTCTGTGCCATTATATTCCTAATGGTTTGTTGGCAAATTCTATTA
rJMSF049B02+ GAAAAAAATGCACTTCTGTGCCATTATATTCCTAATGGTTTGTTGGCAAATTCTATTA
rJMFF003C18+ GAAAAAAATGCACTTCTGNGCCATTAT
rJMSF022H20+ GAAAAAAATGCACTTCTGTGCCATTATATTCCTAATGGTTTGTTGGCAAATTCTATTATG
                      ____________________________________________________________
consensus GAAAAAAATGCACTTCTGTGCCATTATATTCCTAATGGTTTGTTGGCAAATTCTATTATG