Previous Contig 012256:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF014A05Sequence531000730 (3)760012256 (2)gb:AY084533_15696226e-60Arabidopsis thaliana clone 111031 mRNA, complete sequence.>gb:BT001920_1635523 A
JMSF022H05Sequence118019250763012256 (2)gb:AP004585_18418862e-59Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 8, PAC clone:P047

Alignment

This contig is upended


. : . : . : . : . : . :
rJMFF014A05+ CTGACTCATGAGAAAACTGGAAGCTTACCAGAAAAGG
                      ____________________________________________________________
consensus CTGACTCATGAGAAAACTGGAAGCTTACCAGAAAAGG
 
. : . : . : . : . : . :
rJMFF014A05+ AATCTGGTGGAAGTAAAATTGATGGTCAATCTGCTGAGATGCTTAATGGGGAGAAGGGCA
rJMSF022H05+ AAATTGATGGTCAATCTGCTGAGATGCTTAAT-GGGAGAAGGGCA
                      ____________________________________________________________
consensus AATCTGGTGGAAGTAAAATTGATGGTCAATCTGCTGAGATGCTTAATGGGGAGAAGGGCA
 
. : . : . : . : . : . :
rJMFF014A05+ GCAAAAACGCTGTTCTCAGGAAGAGAAACAGTGGTGGTGATGATGGTAAACTTGAAACCA
rJMSF022H05+ GC-AAAACGCTGTTCTCAGGAAGAGAAACAGTGGTGGTGATGATGGTAAACTTGAAACCA
                      ____________________________________________________________
consensus GCAAAAACGCTGTTCTCAGGAAGAGAAACAGTGGTGGTGATGATGGTAAACTTGAAACCA
 
. : . : . : . : . : . :
rJMFF014A05+ ACGGAGAGGCTTTAAATTCATCCAAAGATAGTGCTAAATCCACCAAAGATGGGCCTGCTA
rJMSF022H05+ ACGGAGAGGCTTTAAATTCATCCAAAGATAGTGCTAAATCCACCAAAGAAGGGCCTGCTA
                      ____________________________________________________________
consensus ACGGAGAGGCTTTAAATTCATCCAAAGATAGTGCTAAATCCACCAAAGATGGGCCTGCTA
 
. : . : . : . : . : . :
rJMFF014A05+ AATCACAGTCAAGCCTGGTGTTTGGTTATCTCAATCTCTTCTCTGATGGTGTTCATAATT
rJMSF022H05+ AATCACAGTCAAGCCTGGTGTTTGGTTATCTCAATCTCTTCTCTGATGGTGTTCATAATT
                      ____________________________________________________________
consensus AATCACAGTCAAGCCTGGTGTTTGGTTATCTCAATCTCTTCTCTGATGGTGTTCATAATT
 
. : . : . : . : . : . :
rJMFF014A05+ TTACTGATGGGATGGCATTAGGTAGTGCTTTCCTGCTTTATGGATCAGTTGGTGGGTGGT
rJMSF022H05+ TTACTGATGGGATGGCATTAGGTAGTGCTTTCCTGCTTTATGGATCAGTTGGTGGGTGGT
                      ____________________________________________________________
consensus TTACTGATGGGATGGCATTAGGTAGTGCTTTCCTGCTTTATGGATCAGTTGGTGGGTGGT
 
. : . : . : . : . : . :
rJMFF014A05+ CAAGAACATTGTTTCTGCTTGCTCATGAGCTTCCTCAGGAGATAGGTGACTTTGGAATCT
rJMSF022H05+ CAAGAACATTGTTTCTGCTTGCTCATGAGCTTCCTCAGGAGATAGGTGACTTTGGAATCT
                      ____________________________________________________________
consensus CAAGAACATTGTTTCTGCTTGCTCATGAGCTTCCTCAGGAGATAGGTGACTTTGGAATCT
 
. : . : . : . : . : . :
rJMFF014A05+ TGGTGAGGTCTGGTTTCAGTGTTTCGAAAGCATTGTTTTTTAACTTCTTATCGGCACTAA
rJMSF022H05+ TGGTGAGGTCTGGTTTCAGTGTTTCGAAAGCATTGTTTTTTAACTTCTTATCGGCACTAA
                      ____________________________________________________________
consensus TGGTGAGGTCTGGTTTCAGTGTTTCGAAAGCATTGTTTTTTAACTTCTTATCGGCACTAA
 
. : . : . : . : . : . :
rJMFF014A05+ TGGCACTTGCAGGAACTGCACTGGCCTTGGTGCTAGGACAAGATCCAGGGCAGTCATCAT
rJMSF022H05+ TGGCACTTGCAGGAACTGCACTGGCCTTGGTGCTAGGACAAGATCCAGGGCAGTCATCAT
                      ____________________________________________________________
consensus TGGCACTTGCAGGAACTGCACTGGCCTTGGTGCTAGGACAAGATCCAGGGCAGTCATCAT
 
. : . : . : . : . : . :
rJMFF014A05+ TGATTGAGGGATTCACAGCAGGTGGGTTTATTTACGTTGCAGTTGCGGGAGTGCTGGCAG
rJMSF022H05+ TGATTGAGGGATTCACAGCAGGTGGGTTTATTTACGTTGCAGTTGCGGGAGTGCTGGCAG
                      ____________________________________________________________
consensus TGATTGAGGGATTCACAGCAGGTGGGTTTATTTACGTTGCAGTTGCGGGAGTGCTGGCAG
 
. : . : . : . : . : . :
rJMFF014A05+ AATCAAACAGCGGCAGCTCCTTATCCGTTAAGAGTACGGTGATTCAACTAATCTCTTTGT
rJMSF022H05+ AATCAAACAGCGGCAGCTCCTTATCCGTTAAGAGTACGGTGATTCAACTAATCTCTTTGT
                      ____________________________________________________________
consensus AATCAAACAGCGGCAGCTCCTTATCCGTTAAGAGTACGGTGATTCAACTAATCTCTTTGT
 
. : . : . : . : . : . :
rJMFF014A05+ CGTTAGGCATGGCTGTGGCTCTTTCAATATCTCTTGTAGAATAGAATGATGCTATGATAT
rJMSF022H05+ CGTTAGGCATGGCTGTGGCTCTTTCAATATCTCTTGTAGAATAGAATGATGCTATGATAT
                      ____________________________________________________________
consensus CGTTAGGCATGGCTGTGGCTCTTTCAATATCTCTTGTAGAATAGAATGATGCTATGATAT
 
. : . : . : . : . : . :
rJMFF014A05+ GCTGTGTAGCACGTACGTCACGTCACGGTTGCATTAATGGCTTCTTTCTCCTATGCTCAA
rJMSF022H05+ GCTGTGTAGCACGTACGTCACGTCACGGTTGCATTAATGGCTTCTTTCTCCTATGCTCAA
                      ____________________________________________________________
consensus GCTGTGTAGCACGTACGTCACGTCACGGTTGCATTAATGGCTTCTTTCTCCTATGCTCAA
 
. : . : . : . : . : . :
rJMFF014A05+ TTT
rJMSF022H05+ TTTTCCAATACGAATTTGGTTGTCTGTAGCAATGTGCACTTCCTGGCTTATTATCGTGCT
                      ____________________________________________________________
consensus TTTTCCAATACGAATTTGGTTGTCTGTAGCAATGTGCACTTCCTGGCTTATTATCGTGCT