Previous Contig 012252:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFN018J19Sequence635012252 (4)gb:BT015418_16422462e-86Arabidopsis thaliana At2g32230 gene, complete cds.
JMSF017H02Sequence258019022749012252 (4)gb:BT015418_16422464e-81Arabidopsis thaliana At2g32230 gene, complete cds.
JMSF022G14Sequence660012252 (4)gb:BT015418_16422467e-80Arabidopsis thaliana At2g32230 gene, complete cds.794012252 (4)gb:BT015418_16422462e-80Arabidopsis thaliana At2g32230 gene, complete cds.

Alignment

This contig is upended


. : . : . : . : . : . :
JMFN018J19- CTGAGATGAGTGAGACAGGAGTGTGTCAT
                      ____________________________________________________________
consensus CTGAGATGAGTGAGACAGGAGTGTGTCAT
 
. : . : . : . : . : . :
JMFN018J19- TCATGTGGGGAGAAGCTTGTAAGCATTGATATTGATCCTAGGGAGACGGAGAATTTTGCT
                      ____________________________________________________________
consensus TCATGTGGGGAGAAGCTTGTAAGCATTGATATTGATCCTAGGGAGACGGAGAATTTTGCT
 
. : . : . : . : . : . :
JMFN018J19- AATTCTTTGGCAAAGTTGGCTTCTGAAAGAGAAGCCAAAAATAACTTTTTACAATTTCAG
                      ____________________________________________________________
consensus AATTCTTTGGCAAAGTTGGCTTCTGAAAGAGAAGCCAAAAATAACTTTTTACAATTTCAG
 
. : . : . : . : . : . :
JMFN018J19- GAGTGGCTTAAGAGGAATGGTCCATTTGATGCAGTGGTAGATGGTGCAAATGTTAGCCTC
JMSF022G14- GAGTGGCTTAAGAGGAATGGTCCATTTGATGCAGTGGTAGATGGTGCAAATGTTAGCCTC
rJMSF017H02+ GAGTGGCTTAAGAGGAATGGTCCATTTGATGCAGTGGTAGATGGTGCAAATGTTAGCCTC
rJMSF022G14+ GAGTGGCTTAAGAGGAATGGTCCATTTGATGCAGTGGTAGATGGTGCAAATGTTAGCCTC
                      ____________________________________________________________
consensus GAGTGGCTTAAGAGGAATGGTCCATTTGATGCAGTGGTAGATGGTGCAAATGTTAGCCTC
 
. : . : . : . : . : . :
JMFN018J19- CTTAATAACCGAGACTTTAGTTTTTTACAGCTCAAATCTGTTGTGAATCAATTACATCAA
JMSF022G14- CTTAATAACCGAGACTTTAGTTTTTTACAGCTCAAATCTGTTGTGAATCAATTACATCAA
rJMSF017H02+ CTTAATAACCGAGACTTTAGTTTTTTACAGCTCAAATCTGTTGTGAATCAATTACATCAA
rJMSF022G14+ CTTAATAACCGAGACTTTAGTTTTTTACAGCTCAAATCTGTTGTGAATCAATTACATCAA
                      ____________________________________________________________
consensus CTTAATAACCGAGACTTTAGTTTTTTACAGCTCAAATCTGTTGTGAATCAATTACATCAA
 
. : . : . : . : . : . :
JMFN018J19- ATGAGCAAATCAAAGCAACTGCCACTTGTTGTATTGCATAAAAATCGTATAACTGGAGGA
JMSF022G14- ATGAGCAAATCAAAGCAACTGCCACTTGTTGTATTGCATAAAAATCGTATAACTGGAGGA
rJMSF017H02+ ATGAGCAAATCAAAGCAACTGCCACTTGTTGTATTGCATAAAAATCGTATAACTGGAGGA
rJMSF022G14+ ATGAGCAAATCAAAGCAACTGCCACTTGTTGTATTGCATAAAAATCGTATAACTGGAGGA
                      ____________________________________________________________
consensus ATGAGCAAATCAAAGCAACTGCCACTTGTTGTATTGCATAAAAATCGTATAACTGGAGGA
 
. : . : . : . : . : . :
JMFN018J19- CCTGCTGTCCATCCTAAGAACAAGAAGCTGCTAGAAAGCTGGAAAAAGGCTGGTGCACTT
JMSF022G14- CCTGCTGTCCATCCTAAGAACAAGAAGCTGCTAGAAAGCTGGAAAAAGGCTGGTGCACTT
rJMSF017H02+ CCTGCTGTCCATCCTAAGAACAAGAAGCTGCTAGAAAGCTGGAAAAAGGCTGGTGCACTT
rJMSF022G14+ CCTGCTGTCCATCCTAAGAACAAGAAGCTGCTAGAAAGCTGGAAAAAGGCTGGTGCACTT
                      ____________________________________________________________
consensus CCTGCTGTCCATCCTAAGAACAAGAAGCTGCTAGAAAGCTGGAAAAAGGCTGGTGCACTT
 
. : . : . : . : . : . :
JMFN018J19- TATGCTACTCCATTCGGTTCAAACGATGATTGGTATTGGTTATATGCTGCTGTTAGTTGC
JMSF022G14- TATGCTACTCCATTCGGTTCAAACGATGATTGGTATTGGTTATATGCTGCTGTTAGTTGC
rJMSF017H02+ TATGCTACTCCATTCGGTTCAAACGATGATTGGTATTGGTTATATGCTGCTGTTAGTTGC
rJMSF022G14+ TATGCTACTCCATTCGGTTCAAACGATGATTGGTATTGGTTATATGCTGCTGTTAGTTGC
                      ____________________________________________________________
consensus TATGCTACTCCATTCGGTTCAAACGATGATTGGTATTGGTTATATGCTGCTGTTAGTTGC
 
. : . : . : . : . : . :
JMFN018J19- AAGTGTTTGCTGGTGACAAATGATGAGATGAGAGATCACCTATTCCAGCTGTTAGGGACT
JMSF022G14- AAGTGTTTGCTGGTGACAAATGATGAGATGAGAGATCACCTATTCCAGCTGTTAGGGACT
rJMSF017H02+ AAGTGTTTGCTGGTGACAAATGATGAGATGAGAGATCACCTATTCCAGCTGTTAGGGACT
rJMSF022G14+ AAGTGTTTGCTGGTGACAAATGATGAGATGAGAGATCACCTATTCCAGCTGTTAGGGACT
                      ____________________________________________________________
consensus AAGTGTTTGCTGGTGACAAATGATGAGATGAGAGATCACCTATTCCAGCTGTTAGGGACT
 
. : . : . : . : . : . :
JMFN018J19- AGCTTCTTCCCCAGATGGAAGGAAAAACATCAGATCCGGATGACTGCATCTAGAGAACAT
JMSF022G14- AGCTTCTTCCCCAGATGGAAGGAAAAACATCAGATCCGGATGACTGCATCTAGAGAACAT
rJMSF017H02+ AGCTTCTTCCCCAGATGGAAGGAAAAACATCAGATCCGGATGACTGCATCTAGAGAACAT
rJMSF022G14+ AGCTTCTTCCCCAGATGGAAGGAAAAACATCAGATCCGGATGACTGCATCTAGAGAACAT
                      ____________________________________________________________
consensus AGCTTCTTCCCCAGATGGAAGGAAAAACATCAGATCCGGATGACTGCATCTAGAGAACAT
 
. : . : . : . : . : . :
JMFN018J19- GGACTTAATCTACACATGCCTCCTNCATATTCAATTGTTATGCAGGGAGTCGGA-GAGGG
JMSF022G14- GGACTTAATCTACACATGCCTCCTCCATATTCAATTGTTATGCA-GGAGTCGGAGGAGGG
rJMSF017H02+ GGACTTAATCTACACATGCCTCCTCCATATTCAATTGTTATGCA-GGAGTCGGAGGAGGG
rJMSF022G14+ GGACTTAATCTACACATGCCTCCTCCATATTCAATTGTTATGCA-GGAGTCGGAGGAGGG
                      ____________________________________________________________
consensus GGACTTAATCTACACATGCCTCCTCCATATTCAATTGTTATGCA-GGAGTCGGAGGAGGG
 
. : . : . : . : . : . :
JMFN018J19- CAATTGG
JMSF022G14- CAATTGGCACGTACCAACAGTAATCGGGGATGACCTTGAAACACCACGTAAATGGTTGTG
rJMSF017H02+ CAATTGGCACGTACCAACAGTAATCGGGGATGACCTTGAAACACCACGTAAATGGTTGTG
rJMSF022G14+ CAATTGGCACGTACCAACAGTAATCGGGGATGACCTTGAAACACCACGTAAATGGTTGTG
                      ____________________________________________________________
consensus CAATTGGCACGTACCAACAGTAATCGGGGATGACCTTGAAACACCACGTAAATGGTTGTG
 
. : . : . : . : . : . :
JMSF022G14- CGCCAG
rJMSF017H02+ CGCCAGCAGGAAGCGGAGAAAGGCACTGCACTCTCTCTTCTAGTAAACGCAGAGGTTTCA
rJMSF022G14+ CGCCAGCAGGAAGCGGAGAAAGGCACTGCACTCTCTCTTCTAGTAAACGCAGAGGTTTCA
                      ____________________________________________________________
consensus CGCCAGCAGGAAGCGGAGAAAGGCACTGCACTCTCTCTTCTAGTAAACGCAGAGGTTTCA
 
. : . : . : . : . : . :
rJMSF017H02+ AGTTCATGAGTTCAAAAGCGACATTAGTATAGTATAATGTTAGAACAAATGACCCCATTA
rJMSF022G14+ AGTTCATGAGTTCAAAAGCGACATTAGTATAGTATAATGTTAGAACAAATGACCCCATTA
                      ____________________________________________________________
consensus AGTTCATGAGTTCAAAAGCGACATTAGTATAGTATAATGTTAGAACAAATGACCCCATTA
 
. : . : . : . : . : . :
rJMSF017H02+ ATGTAACCAACAC
rJMSF022G14+ ATGTAACCAACACTAAGCAAGCACATTACTTTTGGGCAATATCCAAGAATTTTCAGAGAT
                      ____________________________________________________________
consensus ATGTAACCAACACTAAGCAAGCACATTACTTTTGGGCAATATCCAAGAATTTTCAGAGAT