Previous Contig 012247:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF006C05Sequence576000465 (9)sp|Q42857|SSG1_IPOBAe-105Granule-bound starch synthase I, chloroplast precursor (EC 2.4.1.21).>gb:AB07160765012247 (6)pir|T10906|T109063e-82starch synthase (EC 2.4.1.21) - sweet potato>gb:IBU44126_1682979 Ipomoea batatas
JMFF008O13Sequence490000465 (9)sp|Q42857|SSG1_IPOBA2e-54Granule-bound starch synthase I, chloroplast precursor (EC 2.4.1.21).>gb:AB07160682012247 (6)pir|T10906|T109064e-60starch synthase (EC 2.4.1.21) - sweet potato>gb:IBU44126_1682979 Ipomoea batatas
JMFF018C11Sequence572000465 (9)sp|Q42857|SSG1_IPOBA1e-70Granule-bound starch synthase I, chloroplast precursor (EC 2.4.1.21).>gb:AB07160768012247 (6)pir|T10906|T109063e-82starch synthase (EC 2.4.1.21) - sweet potato>gb:IBU44126_1682979 Ipomoea batatas
JMFF022M03Sequence532000465 (9)sp|Q42857|SSG1_IPOBA6e-61Granule-bound starch synthase I, chloroplast precursor (EC 2.4.1.21).>gb:AB07160514012247 (6)pir|T10906|T109063e-28starch synthase (EC 2.4.1.21) - sweet potato>gb:IBU44126_1682979 Ipomoea batatas
JMFS080H06Sequence626012247 (6)pir|T10906|T109067e-72starch synthase (EC 2.4.1.21) - sweet potato>gb:IBU44126_1682979 Ipomoea batatas
JMSF022F11Sequence624000465 (9)sp|Q42857|SSG1_IPOBA3e-99Granule-bound starch synthase I, chloroplast precursor (EC 2.4.1.21).>gb:AB07160770012247 (6)pir|T10906|T109064e-71starch synthase (EC 2.4.1.21) - sweet potato>gb:IBU44126_1682979 Ipomoea batatas

Alignment

This contig is upended


. : . : . : . : . : . :
rJMFF006C05+ CTGGGAAGAAGAAATTTGAGCAGGAGATTGAGCAGCTTGAAGTGATGTAT
rJMFF018C11+ CTGGGAAGAAGAAATTTGAGCAGGAGATTGAGCAGCTTGAAGTGATGTAT
                      ____________________________________________________________
consensus CTGGGAAGAAGAAATTTGAGCAGGAGATTGAGCAGCTTGAAGTGATGTAT
 
. : . : . : . : . : . :
rJMFF006C05+ CCGGACAAAGCTAGAGGAGTGGCAAAGTTCAACGTTCCTTTGGCTCACATGATTACTGCG
JMFS080H06- AGCTAGAGGAGTGGCAAAGTTCAACGTTCCTTTGGCTCACATGATTACTGCG
rJMFF018C11+ CCGGACAAAGCTAGAGGAGTGGCAAAGTTCAACGTTCCTTTGGCTCACATGATTACTGCG
rJMFF008O13+ CACATGATTACTGCG
rJMSF022F11+ AGCTAGAGGAGTGGCCAAGTTCAACGTTCCTTTGGCTCACATGATTACTGCG
                      ____________________________________________________________
consensus CCGGACAAAGCTAGAGGAGTGGCAAAGTTCAACGTTCCTTTGGCTCACATGATTACTGCG
 
. : . : . : . : . : . :
rJMFF006C05+ GGTGCTGATTTTATGATGAT-CCCGAGCAGATTCGAACCGTGTGGTCTCATTCAGTTGCA
JMFS080H06- GGTGCTGATTTTATGATGAT-CCCGAGCAGATTCGAACCGTGTGGTCTCATTCAGTTGCA
rJMFF018C11+ GGTGCTGATTTTATGATGAT-CCCGAGCAGATTCGAACCGTGTGGTCTCATTCAGTTGCA
rJMFF008O13+ GGTGCTGATTTTATGATGATCCCCGAGCAGATTCGAACCGTGTGGTCTCATTCAGTTGCA
rJMSF022F11+ GGTGCTGATTTTATGATGAT-CCCGAGCAGATTCGAACCGTGTGGTCTCATTCAGTTGCA
                      ____________________________________________________________
consensus GGTGCTGATTTTATGATGAT-CCCGAGCAGATTCGAACCGTGTGGTCTCATTCAGTTGCA
 
. : . : . : . : . : . :
rJMFF006C05+ TGCTATGCGATATGGAACACCGTGCATCTGTGCCTCAACTGGCGGACTTGTTGACACCGT
JMFS080H06- TGCTATGCGATATGGAACACCGTGCATCTGTGCCTCAACTGGCGGACTTGTTGACACCGT
rJMFF018C11+ TGCTATGCGATATGGAACACCGTGCATCTGTGCCTCAACTGGCGGACTTGTTGACACCGT
rJMFF008O13+ TGCTATGCGATATGGAACACCGTGCATCTGTGCCTCAACTGGCGGACTTGTTGACACCGT
rJMSF022F11+ TGCTATGCGATATGGAACACCGTGCATCTGTGCCTCAACTGGCGGACTTGTTGACACCGT
                      ____________________________________________________________
consensus TGCTATGCGATATGGAACACCGTGCATCTGTGCCTCAACTGGCGGACTTGTTGACACCGT
 
. : . : . : . : . : . :
rJMFF006C05+ GAAAGAAGGTTATACAGGGTTCCACATGGGGGATTTCAAC-GTCAAGTGTGAAACTGTTG
JMFS080H06- GAAAGAAGGTTATACAGGGTTCCACATGGGGGATTTCAAC-GTCAAGTGTGAAACTGTTG
rJMFF018C11+ GAAAGAAGGTTATACAGGGTTCCACATGGGGGATTTCAAC-GTCAAGTGTGAAACTGTTG
rJMFF022M03+ CACATGGGGGATTTCAACGGTCAAGTGTGANACTGTTG
rJMFF008O13+ GAAAGAAGGTTATACAGGGTTCCACATGGGGGATTTCAAC-GTCAAGTGTGAAACTGTTG
rJMSF022F11+ GAAAGAAGGTTATACAGGGTTCCACATGGGGGATTTCAAC-GTCAAGTGTGAAACTGTTG
                      ____________________________________________________________
consensus GAAAGAAGGTTATACAGGGTTCCACATGGGGGATTTCAAC-GTCAAGTGTGAAACTGTTG
 
. : . : . : . : . : . :
rJMFF006C05+ ACCCAGAGGACGTGCTGAAGGTGATAACCACTGTCGAAAGAGCACTTGCAGTGTACGGAA
JMFS080H06- ACCCAGAGGACGTGCTGAAGGTGATAACCACTGTCGAAAGAGCACTTGCAGTGTACGGAA
rJMFF018C11+ ACCCAGAGGACGTGCTGAAGGTGATAACCACTGTCGAAAGAGCACTTGCAGTGTACGGAA
rJMFF022M03+ ACCCAGAGGACGTGCTGAAGGTGATAACCACTGTCGAAAGAGCACTTGCAGTGTACGGAA
rJMFF008O13+ ACCCAGAGGACGTGCTGAAGGTGATAACCACTGTCGAAAGAGCACTTGCAGTGTACGGAA
rJMSF022F11+ ACCCAGAGGACGTGCTGAAGGTGATAACCACTGTCGAAAGAGCACTTGCAGTGTACGGAA
                      ____________________________________________________________
consensus ACCCAGAGGACGTGCTGAAGGTGATAACCACTGTCGAAAGAGCACTTGCAGTGTACGGAA
 
. : . : . : . : . : . :
rJMFF006C05+ CCCTTGCATTCGCCGAAATGATCCAGAACTGCATGTCACAAGAGCTTTCCTGGAAGGGAC
JMFS080H06- CCCTTGCATTCGCCGAAATGATCCAGAACTGCATGTCACAAGAGCTTTCCTGGAAGGGAC
rJMFF018C11+ CCCTTGCATTCGCCGAAATGATCCAGAACTGCATGTCACAAGAGCTTTCCTGGAAGGGAC
rJMFF022M03+ CCCTTGCATTCGCCGAAATGATCCAGAACTGCATGTCACAAGAGCTATCCTGGAAGGGAC
rJMFF008O13+ CCCTTGCATTCGCCGAAATGATCCAGAACTGCATGTCACAAGAGCTATCCTGGAAGGGAC
rJMSF022F11+ CCCTTGCATTCGCCGAAATGATCCAGAACTGCATGTCACAAGAGCTTTCCTGGAAGGGAC
                      ____________________________________________________________
consensus CCCTTGCATTCGCCGAAATGATCCAGAACTGCATGTCACAAGAGCTTTCCTGGAAGGGAC
 
. : . : . : . : . : . :
rJMFF006C05+ CTGCCAAGAATTGGGAAACAATGCTGTTGAACTTAGGAGTTGCTGGGAGCGAGGCCGGGG
JMFS080H06- CTGCCAAGAATTGGGAAACAATGCTGTTGAACTTAGGAGTTGCTGGGAGCGAGGCCGGGG
rJMFF018C11+ CTGCCAAGAATTGGGAAACAATGCTGTTGAACTTAGGAGTTGCTGGGAGCGAGGCCGGGG
rJMFF022M03+ CTGCCAAGAATTGGGAAACAATGCTTTTGAACTTAGGAGTTGCTGGGAGCGAGGCCGGGG
rJMFF008O13+ CTGCCAAGAATTGGGAAACAATGCTTTTGAACTTAGGAGTTGCTGGGAGCGAGGCCGGGG
rJMSF022F11+ CTGCCAAGAATTGGGAAACAATGCTGTTGAACTTAGGAGTTGCTGGGAGCGAGGCCGGGG
                      ____________________________________________________________
consensus CTGCCAAGAATTGGGAAACAATGCTGTTGAACTTAGGAGTTGCTGGGAGCGAGGCCGGGG
 
. : . : . : . : . : . :
rJMFF006C05+ TTGAAGGAGAGGAAATTGCGCCACTTGCAAAGGAAAACGTCGCGACTCCATGAGATACCA
JMFS080H06- TTGAAGGAGAGGAAATTGCGCCACTTGCAAAGGAAAACGTCGCGACTCCATGAGATACCA
rJMFF018C11+ TTGAAGGAGAGGAAATTGCGCCACTTGCAAAGGAAAACGTCGCGACTCCATGAGATACCA
rJMFF022M03+ TTGAAGGAGAGGAAATTGCGCCACTTGCAAAGGAAAACGTCGCGACTCCATGAGATACCA
rJMFF008O13+ TTGAAGGAGAGGAAATTGCGCCACTTGCAAAGGAAAACGTCGCGACTCCATGAGATACCA
rJMSF022F11+ TTGAAGGAGAGGAAATTGCGCCACTTGCAAAGGAAAACGTCGCGACTCCATGAGATACCA
                      ____________________________________________________________
consensus TTGAAGGAGAGGAAATTGCGCCACTTGCAAAGGAAAACGTCGCGACTCCATGAGATACCA
 
. : . : . : . : . : . :
rJMFF006C05+ TAAGCTCGATTAAGCTGGCATATGAAACTAATAAAGTTTTATATATGTTGAAAGAGCAGA
JMFS080H06- TAAGCTCGATTAAGCTGGCATATGAAACTAATAAAGTTTTATATATGTTGAAAGAGCAGA
rJMFF018C11+ TAAGCTCGATTAAGCTGGCATATGAAACTAATAAAGTTTTATATATGTTGAAAGAGCAGA
rJMFF022M03+ TAAGCTCGATTAAGCTGGCATATGAAACTAATAAAGTTTTATATATGTTGAAAGAGCAGA
rJMFF008O13+ TAAGCTCGATTAAGCTGGCATATGAAACTAATAAAGTTTTATATATGTTGAAAGAGCAGA
rJMSF022F11+ TAAGCTCGATTAAGCTGGCATATGAAACTAATAAAGTTTTATATATGTTGAAAGAGCAGA
                      ____________________________________________________________
consensus TAAGCTCGATTAAGCTGGCATATGAAACTAATAAAGTTTTATATATGTTGAAAGAGCAGA
 
. : . : . : . : . : . :
rJMFF006C05+ GGCGTTTTGGTGGCTCTTGAGCATTATGAGGTGATGAAAGGAGCCAATGG-GGGGACTCT
JMFS080H06- GGCGTTTTGGTGGCTCTTGAGCATTATGAGGTGATGAAAGGAGCCAATGGAGGGGACTCT
rJMFF018C11+ GGCGTTTTGGTGGCTCTTGAGCATTATGAGGTGATGAAAGGAGCCAATGGAGGGGACTCT
rJMFF022M03+ GGCGTTTTGGTGGCTCTTGAGCATTATGAGGTGATGAAAGGAGCCAATGGAGGGGACTCT
rJMFF008O13+ GGCGTTTTGGTGGCTCTTGAGCATTATGAGGTGATGAAAGGAGCCAATGGAGGGGACTCT
rJMSF022F11+ GGCGTTTTGGTGGCTCTTGAGCATTATGAGGTGATGAAAGGAGCCAATGGAGGGGACTCT
                      ____________________________________________________________
consensus GGCGTTTTGGTGGCTCTTGAGCATTATGAGGTGATGAAAGGAGCCAATGGAGGGGACTCT
 
. : . : . : . : . : . :
rJMFF006C05+ TTCTTTATTGTTTTTTGGTAGTAAATAGAGAGAGTTGAAACTAACTAGTTTGGTGTTTTA
JMFS080H06- NTCTTTATTGGTTTTTGGTAGTAAATAGAGAGA
rJMFF018C11+ TTCTTTATTGTTTTTTGGTAGTAAATAGAGAGAGTTGAAACTAACTAGTTTGGTGTTTTA
rJMFF022M03+ TTCTTTATTGTTTTTTGGTAGTAAATAGAGAGAGTTGAAACTAACTAGTTTGGTGTTTTA
rJMFF008O13+ TTCTTTATTGTTTTTTGGTAGTAAATAGAGAGAGTTGAAACTAACTAGTTTGGTGTTTTA
rJMSF022F11+ TTCTTTATTGTTTTTTGGTAGTAAATAGAGAGAGTTGAAACTAACTAGTTTGGTGTTTTA
                      ____________________________________________________________
consensus TTCTTTATTGTTTTTTGGTAGTAAATAGAGAGAGTTGAAACTAACTAGTTTGGTGTTTTA
 
. : . : . : . : . : . :
rJMFF006C05+ AGATATTGGGAACTTTGCACTTGAGCAGGCCAAATGTATAATAATATAAATAAACAAT
rJMFF018C11+ AGATATTGGGAACTTTGCACTTGAGCAGGCCAAATGTATAATAATATAAATAAACAAT
rJMFF022M03+ AGATATTGGGAACTTTGCACTTGAGCAGGCCAAATGTATAATAATATAAATAAACA
rJMFF008O13+ AGATATTGGGAACTTTGCACTTGAGCAGGCCAAATGTATAATAATATAAATAAACAATAA
rJMSF022F11+ AGATATTGGGAACTTTGCACTTGAGCAGGCCAAATGTATAATAATATAAATAAACAATAA
                      ____________________________________________________________
consensus AGATATTGGGAACTTTGCACTTGAGCAGGCCAAATGTATAATAATATAAATAAACAATAA
 
. : . : . : . : . : . :
rJMFF008O13+ TGGCCTCT
rJMSF022F11+ TGGCCTCTTGTGGTTTTGTGCTTTGATTTCCACCAACTTTTGATGAGATGATTNTGCTAT
                      ____________________________________________________________
consensus TGGCCTCTTGTGGTTTTGTGCTTTGATTTCCACCAACTTTTGATGAGATGATTNTGCTAT