Previous Contig 012240:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFS049G11Sequence633012240 (4)gb:AB030083_15183982e-76Populus nigra PnLPK mRNA for lectin-like protein kinase, complete cds.
JMFS143D05Sequence611012240 (4)gb:AB030083_15183981e-72Populus nigra PnLPK mRNA for lectin-like protein kinase, complete cds.
JMFS168C09Sequence522012240 (4)gb:AB030083_15183982e-57Populus nigra PnLPK mRNA for lectin-like protein kinase, complete cds.
JMSF022D20Sequence694019240gb:AB030083_15183984e-42Populus nigra PnLPK mRNA for lectin-like protein kinase, complete cds.799012240 (4)gb:AB030083_15183982e-92Populus nigra PnLPK mRNA for lectin-like protein kinase, complete cds.

Alignment

This contig is upended


. : . : . : . : . : . :
rJMSF022D20+ GGATGGTGCCACAATAAGC
                      ____________________________________________________________
consensus GGATGGTGCCACAATAAGC
 
. : . : . : . : . : . :
rJMSF022D20+ ATGGGAAGTTGCTTCTGGTGTATGAGTACTTGCCTAATGGGAGTTTGGATAAGCATCTGT
                      ____________________________________________________________
consensus ATGGGAAGTTGCTTCTGGTGTATGAGTACTTGCCTAATGGGAGTTTGGATAAGCATCTGT
 
. : . : . : . : . : . :
JMFS049G11+ ACAAGATTGTATCCGGGG
rJMSF022D20+ TCTCAAAGTCAGGGAGAGATCCTCTCAGCTGGAACCTCAGATACAAGATTGTATCCGGGG
                      ____________________________________________________________
consensus TCTCAAAGTCAGGGAGAGATCCTCTCAGCTGGAACCTCAGATACAAGATTGTATCCGGGG
 
. : . : . : . : . : . :
JMFS049G11+ TCGCNTCGGCCTTGCACTATCTGCACAACGAGTACGAGCAGAAAGTGGTGCACCGCGACC
JMFS143D05+ CGGCCTTGCACTATCTGCACAACGAGTACGAGCAGAAAGTGGTGCACCGCGACC
rJMSF022D20+ TCGCCTCGGCCTTGCACTATCTGCACAACGAGTACGAGCAGAAAGTGGTGCACCGCGACC
                      ____________________________________________________________
consensus TCGCCTCGGCCTTGCACTATCTGCACAACGAGTACGAGCAGAAAGTGGTGCACCGCGACC
 
. : . : . : . : . : . :
JMFS168C09+ TCAACGCCCGCCTCGGCGACTTTGGCC
JMFS049G11+ TCAAGCCAAGCAACATCATGCTCGACTCCAGCTTCAACGCCCGCCTCGGCGACTTTGGCC
JMFS143D05+ TCAAGCCAAGCAACATCATGCTCGACTCCAGCTTCAACGCCCGCCTCGGCGACTTTGGCC
rJMSF022D20+ TCAAGCCAAGCAACATCATGCTCGACTCCAGCTTCAACGCCCGCCTCGGCGACTTTGGCC
                      ____________________________________________________________
consensus TCAAGCCAAGCAACATCATGCTCGACTCCAGCTTCAACGCCCGCCTCGGCGACTTTGGCC
 
. : . : . : . : . : . :
JMFS168C09+ TGGCACGGGCGCTAGAGAACGAGAGATCCTCCTACTCTGAGACCGCGGGAGTGACGGGCA
JMFS049G11+ TGGCACGGGCGCTAGAGAACGAGAGATCCTCCTACTCTGAGACCGCGGGAGTGACGGGCA
JMFS143D05+ TGGCACGGGCGCTAGAGAACGAGAGATCCTCCTACTCTGAGACCGCGGGAGTGACGGGCA
rJMSF022D20+ TGGCACGGGCGCTAGAGAACGAGAGATCCTCCTACTCTGAGACCGCGGGAGTGACGGGCA
                      ____________________________________________________________
consensus TGGCACGGGCGCTAGAGAACGAGAGATCCTCCTACTCTGAGACCGCGGGAGTGACGGGCA
 
. : . : . : . : . : . :
JMFS168C09+ CAATAGGCTACATTGCGCCCGAGTGTTTCCACACCGGAAAGGCCACTCAACAATCTGATG
JMFS049G11+ CAATAGGCTACATTGCGCCCGAGTGTTTCCACACCGGAAAGGCCACTCAACAATCTGATG
JMFS143D05+ CAATAGGCTACATTGCGCCCGAGTGTTTCCACACCGGAAAGGCCACTCAACAATCTGATG
rJMSF022D20+ CAATAGGCTACATTGCGCCCGAGTGTTTCCACACCGGAAAGGCCACTCAACAATCTGATG
                      ____________________________________________________________
consensus CAATAGGCTACATTGCGCCCGAGTGTTTCCACACCGGAAAGGCCACTCAACAATCTGATG
 
. : . : . : . : . : . :
JMFS168C09+ TCTACGCGTTTGGGGCGGTCGTGCTGGAAGTAGTGTGTGGCAAGCGGGCTGGAGCCTCGA
JMFS049G11+ TCTACGCGTTTGGGGCGGTCGTGCTGGAAGTAGTGTGTGGCAAGCGGGCTGGAGCCTCGA
JMFS143D05+ TCTACGCGTTTGGGGCGGTCGTGCTGGAAGTAGTGTGTGGCAAGCGGGCTGGAGCCTCGA
rJMSF022D20+ TCTACGCGTTTGGGGCGGTCGTGCTGGAAGTAGTGTGTGGCAAGCGGGCTGGAGCCTCGA
                      ____________________________________________________________
consensus TCTACGCGTTTGGGGCGGTCGTGCTGGAAGTAGTGTGTGGCAAGCGGGCTGGAGCCTCGA
 
. : . : . : . : . : . :
JMFS168C09+ TTGGCGGTTTTCAATACTTGGTAGATTGGGTTTGGCACTTACACCGTGATGGACGGATTG
JMFS049G11+ TTGGCGGTTTTCAATACTTGGTAGATTGGGTTTGGCACTTACACCGTGATGGACGGATTG
JMFS143D05+ TTGGCGGTTTTCAATACTTGGTAGATTGGGTTTGGCACTTACACCGTGATGGACGGATTG
rJMSF022D20+ TTGGCGGTTTTCAATACTTGGTAGATTGGGTTTGGCACTTACACCGTGATGGACGGATTG
                      ____________________________________________________________
consensus TTGGCGGTTTTCAATACTTGGTAGATTGGGTTTGGCACTTACACCGTGATGGACGGATTG
 
. : . : . : . : . : . :
JMFS168C09+ TAGATGCAGTTGATGGGACACTGGGAGACGAGTATTCTGTCAGAGGAAGCTGAGAGGCTG
JMFS049G11+ TAGATGCAGTTGATGGGACACTGGGAGACGAGTATTCTGTCAGAGGAAGCTGAGAGGCTG
JMFS143D05+ TAGATGCAGTTGATGGGACACTGGGAGACGAGTATTCTGTCAGAGGAAGCTGAGAGGCTG
rJMSF022D20+ TAGATGCAGTTGATGGGACACTGGGAGACGAGTATTCTGTCAGAGGAAGCTGAGAGGCTG
                      ____________________________________________________________
consensus TAGATGCAGTTGATGGGACACTGGGAGACGAGTATTCTGTCAGAGGAAGCTGAGAGGCTG
 
. : . : . : . : . : . :
JMFS168C09+ CTGCTCCTTGGGCTGGTTTGCTCACATCCTATTGCCAACCAGAGGCCACAAACATCGGCC
JMFS049G11+ CTGCTCCTTGGGCTGGTTTGCTCACATCCTATTGCCAACCAGAGGCCACAAACATCGGCC
JMFS143D05+ CTGCTCCTTGGGCTGGTTTGCTCACATCCTATTGCCAACCAGAGGCCACAAACATCGGCC
rJMSF022D20+ CTGCTCCTTGGGCTGGTTTGCTCACATCCTATTGCCAACCAGAGGCCACAAACATCGGCC
                      ____________________________________________________________
consensus CTGCTCCTTGGGCTGGTTTGCTCACATCCTATTGCCAACCAGAGGCCACAAACATCGGCC
 
. : . : . : . : . : . :
JMFS168C09+ ATAGTTCAAATGATACTAGGATTTTTACCTGTGCCACATGTTCCACCCTTCAAGCCTTCA
JMFS049G11+ ATAGTTCAAATGATACTAGGATTTTTACCTGTGCCACATGTTCCACCCTTCAAGCCTTCA
JMFS143D05+ ATAGTTCAAATGATACTAGGATTTTTACCTGTGCCACATGTTCCACCCTTCAAGCCTTCA
rJMSF022D20+ ATAGTTCAAATGATACTAGGATTTTTACCTGTGCCACATGTTCCACCCTTCAAGCCTTCA
                      ____________________________________________________________
consensus ATAGTTCAAATGATACTAGGATTTTTACCTGTGCCACATGTTCCACCCTTCAAGCCTTCA
 
. : . : . : . : . : . :
JMFS168C09+ TTTGTGTGGCCTTCCATGGCTCCAACCAGCTTAGATTCTAGTATAACTGAAACCTCAACC
JMFS049G11+ TTTGTGTGGCCTTCCATGGCTCCAACCAGCTTAGATTCTAGTATAACTGAAACCTCAACC
JMFS143D05+ TTTGTGTGGCCTTCCATGGCTCCAACCAGCTTAGATTCTAGTATAACTGAAACCTCAACC
rJMSF022D20+ TTTGTGTGGCCTTCCATGGCTCCAACCAGCTTAGATTCTAGTATAACTGAAACCTCAACC
                      ____________________________________________________________
consensus TTTGTGTGGCCTTCCATGGCTCCAACCAGCTTAGATTCTAGTATAACTGAAACCTCAACC
 
. : . : . : . : . : . :
JMFS168C09+ TTTACAGGTTCTCTG
JMFS049G11+ TTTACAGGTTCTCTG
JMFS143D05+ TTTACAGGTTCTCTG
rJMSF022D20+ TTTACAGGTTCTCTGGATAGCTCTGCAGTGTACACTCAATAGTTATGCTCAGATCAGATA
                      ____________________________________________________________
consensus TTTACAGGTTCTCTGGATAGCTCTGCAGTGTACACTCAATAGTTATGCTCAGATCAGATA