Previous Contig 012230:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF008N07Sequence536000459 (11)gb:AC002337_15304681e-34Arabidopsis thaliana chromosome 2 clone T8I13 map CIC06C03, complete sequence.>g688012230 (9)gb:AC002337_15304684e-32Arabidopsis thaliana chromosome 2 clone T8I13 map CIC06C03, complete sequence.>g
JMFF010N09Sequence649000459 (11)gb:AC002337_15304682e-55Arabidopsis thaliana chromosome 2 clone T8I13 map CIC06C03, complete sequence.>g772012230 (9)gb:AC002337_15304689e-43Arabidopsis thaliana chromosome 2 clone T8I13 map CIC06C03, complete sequence.>g
JMFF014M03Sequence578000459 (11)gb:AC002337_15304683e-53Arabidopsis thaliana chromosome 2 clone T8I13 map CIC06C03, complete sequence.>g820012230 (9)gb:AC002337_15304682e-47Arabidopsis thaliana chromosome 2 clone T8I13 map CIC06C03, complete sequence.>g
JMFF034C07Sequence331000459 (11)gb:AC002337_15304681e-21Arabidopsis thaliana chromosome 2 clone T8I13 map CIC06C03, complete sequence.>g758012230 (9)gb:AC002337_15304682e-45Arabidopsis thaliana chromosome 2 clone T8I13 map CIC06C03, complete sequence.>g
JMFF041A20Sequence633000459 (11)gb:AC002337_15304682e-52Arabidopsis thaliana chromosome 2 clone T8I13 map CIC06C03, complete sequence.>g481012230 (9)gb:AC002337_15304688e-15Arabidopsis thaliana chromosome 2 clone T8I13 map CIC06C03, complete sequence.>g
JMFF043C04Sequence648000459 (11)gb:AC002337_15304682e-54Arabidopsis thaliana chromosome 2 clone T8I13 map CIC06C03, complete sequence.>g626012230 (9)gb:AC002337_15304682e-18Arabidopsis thaliana chromosome 2 clone T8I13 map CIC06C03, complete sequence.>g
JMSF009I24Sequence242000459 (11)gb:AC002337_15304683e-17Arabidopsis thaliana chromosome 2 clone T8I13 map CIC06C03, complete sequence.>g743012230 (9)gb:AC002337_15304682e-41Arabidopsis thaliana chromosome 2 clone T8I13 map CIC06C03, complete sequence.>g
JMSF022A04Sequence650006038 (4)gb:BT005766_16386907e-11Arabidopsis thaliana clone RAFL15-29-O03 (R20957) unknown protein (At5g52900) mR771012230 (9)gb:AC002337_15304687e-19Arabidopsis thaliana chromosome 2 clone T8I13 map CIC06C03, complete sequence.>g
JMSF045O02Sequence712006038 (4)gb:BT005766_16386908e-11Arabidopsis thaliana clone RAFL15-29-O03 (R20957) unknown protein (At5g52900) mR803012230 (9)gb:AC002337_15304688e-19Arabidopsis thaliana chromosome 2 clone T8I13 map CIC06C03, complete sequence.>g

Alignment

This contig is upended


. : . : . : . : . : . :
rJMFF010N09+ CTAAAGACATGGATATGCATGTTCATAGAATTGGTAGAACAGNCCGTG
rJMFF034C07+ GATATGCATGTTCATAGAATTGGTAGANCAGGCCGTG
rJMSF009I24+ TGGTAGAACAGGCCGTG
rJMFF014M03+ TGCTAAAGACATGGATATGCATGTTCATAGAATTGGTAGAACAGNCCGTG
                      ____________________________________________________________
consensus TGCTAAAGACATGGATATGCATGTTCATAGAATTGGTAGAACAGGCCGTG
 
. : . : . : . : . : . :
rJMFF010N09+ CTGGTGATAAAGATGGAACTGCATACACTCTTATTACTCAAAAAGAGGCACGTTTTGCTG
rJMFF034C07+ CTGGTGATAAAGATGGAACTGCATACACTCTTATTACTCAAAAAGAGGCACGTTTTGCTG
rJMSF009I24+ CTGGTGATAAAGATGGAACTGCATACACTCTTATTACTCAAAAAGAGGCACGTTTTGCTG
rJMFF008N07+ ACTCAAAAAGAGGCACGTTTTGCTG
rJMFF014M03+ CTGGTGATAAAGATGGAACTGCATACACTCTTATTACTCAAAAAGAGGCACGTTTTGCTG
                      ____________________________________________________________
consensus CTGGTGATAAAGATGGAACTGCATACACTCTTATTACTCAAAAAGAGGCACGTTTTGCTG
 
. : . : . : . : . : . :
rJMFF010N09+ GAGAATTAGTCAACAGTTTGATTACTGCTGGTCAAAATGTGCCCTGCGGAACTGATGGAC
rJMFF034C07+ GAGAATTAGTCAACAGTTTGATTACTGCTGGTCAAAATGTG-CCTGCGGAACTGATGGAC
rJMSF009I24+ GAGAATTAGTCAACAGTTTGATTACTGCTGGTCAAAATGTG-CCTGCGGAACTGATGGAC
rJMFF008N07+ GAGAATTAGTCAACAGTTTGATTACTGCTGGTCAAAATGTG-CCTGCGGAACTGATGGAC
rJMFF014M03+ GAGAATTAGTCAACAGTTTGATTACTGCTGGTCAAAATGTG-CCTGCGGAACTGATGGAC
                      ____________________________________________________________
consensus GAGAATTAGTCAACAGTTTGATTACTGCTGGTCAAAATGTG-CCTGCGGAACTGATGGAC
 
. : . : . : . : . : . :
rJMFF010N09+ CTTGCAATGAAGGATGGAAGATTTCGTTCCAAACGTGATGCACGGAAAGGA-GGTGGAAA
rJMFF034C07+ CTTGCAATGAAGGATGGAAGATTTCGTTCCAAACGTGATGCACGGAAAGGA-GGTGGAAA
rJMSF009I24+ CTTGCAATGAAGGATGGAAGATTTCGTTCCAAACGTGATGCACGGAAAGGA-GGTGGAAA
rJMFF008N07+ CTTGCAATGAAGGATGGAAGATTTCGTTCCAAACGTGATGCACGGAAAGGA-GGTGGAAA
rJMFF014M03+ CTTGCAATGAAGGATGGAAGATTTCGTTCCAAACGTGATGCACGGAAAGGA-GGTGGAAA
rJMFF043C04+ TCCAAACGTGATGCACGGAAAGGA-GGTGGAAA
rJMSF045O02+ CGTGATGCACGGAAAGGAGGGTGGAAA
                      ____________________________________________________________
consensus CTTGCAATGAAGGATGGAAGATTTCGTTCCAAACGTGATGCACGGAAAGGA-GGTGGAAA
 
. : . : . : . : . : . :
rJMFF010N09+ GAGGGCGAAAGG-AAGGGGAGGCAGTGGTCGAGGTGTGCGTGGCGTGGATTATGGTCTGG
rJMFF034C07+ GAGGGCGAAAGG-AAGGGGAGGCAGTGGTCGAGGTGTGCGTGGCGTGGATTATGGTCTGG
rJMSF009I24+ GAGGGCGAAAGG-AAGGGGAGGCAGTGGTCGAGGTGTGCGTGGCGTGGATTATGGTCTGG
rJMFF008N07+ GAGGGCGAAAGG-AAGGGGAGGCAGTGGTCGAGGTGTGCGTGGCGTGGATTATGGTCTGG
rJMFF014M03+ GAGGGCGAAAGG-AAGGGGAGGCAGTGGTCGAGGTGTGCGTGGCGTGGATTATGGTCTGG
rJMFF043C04+ GAGGGCGAAAGG-AAGGGGAGGCAGTGGTCGAGGTGTGCGTGGCGTGGATTATGGTCTGG
rJMSF045O02+ GAGGGCGAAAGGAAAGGGGAGGCAGTGGTCGAGGTGTGCGTGGCGTGGATTATGGTCTGG
rJMSF022A04+ AAGG-AAGGGGAGNCAGTGGTCGAGGTGTGCGTGGCGTGGATTATGGTCTGG
                      ____________________________________________________________
consensus GAGGGCGAAAGG-AAGGGGAGGCAGTGGTCGAGGTGTGCGTGGCGTGGATTATGGTCTGG
 
. : . : . : . : . : . :
rJMFF010N09+ GTATTGGATACAGTGCAGAATCAAGTAATGCTCCAACTACCACTGTTCCAAGCCGTTCTG
rJMFF034C07+ GTATTGGATACAGTGCAGAATCAAGTAATGCTCCAACTACCACTGTTCCAAGCCGTTCTG
rJMSF009I24+ GTATTGGATACAGTGCAGAATCAAGTAATGCTCCAACTACCACTGTTCCAAGCCGTTCTG
rJMFF008N07+ GTATTGGATACAGTGCAGAATCAAGTAATGCTCCAACTACCACTGTTCCAAGCCGTTCTG
rJMFF041A20+ ATCAAGTAATGCTCCAACTACCCCTGTTTCAAGCCGTTTTG
rJMFF014M03+ GTATTGGATACAGTGCAGAATCAAGTAATGCTCCAACTACCACTGTTCCAAGCCGTTCTG
rJMFF043C04+ GTATTGGATACAGTGCAGAATCAAGTAATGCTCCAACTACCACTGTTCCAAGCCGTTCTG
rJMSF045O02+ GTATTGGATACAGTGCAGAATCAAGTAATGCTCCAACTACCACTGTTCCAAGCCGTTCTG
rJMSF022A04+ GTATTGGATACAGTGCAGAATCAAGTAATGCTCCAACTACCACTGTTCCAAGCCGTTCTG
                      ____________________________________________________________
consensus GTATTGGATACAGTGCAGAATCAAGTAATGCTCCAACTACCACTGTTCCAAGCCGTTCTG
 
. : . : . : . : . : . :
rJMFF010N09+ CAGCAGTAAATTCACTAAGAACCGGGATGATGGCACAGTTTAAGAGCAACTTTGTTGCTG
rJMFF034C07+ CAGCAGTAAATTCACTAAGAACCGGGATGATGGCACAGTTTAAGAGCAACTTTGTTGCTG
rJMSF009I24+ CAGCAGTAAATTCACTAAGAACCGGGATGATGGCACAGTTTAAGAGCAACTTTGTTGCTG
rJMFF008N07+ CAGCAGTAAATTCACTAAGAACCGGGATGATGGCACAGTTTAAGAGCAACTTTGTTGCTG
rJMFF041A20+ CAGCAGTAAATTCACTAAAAACCGGGATGATGGCCCAGTTTAAAAGCAACTTTGTTGCTG
rJMFF014M03+ CAGCAGTAAATTCACTAAGAACCGGGATGATGGCACAGTTTAAGAGCAACTTTGTTGCTG
rJMFF043C04+ CAGCAGTAAATTCACTAAGAACCGGGATGATGGCACAGTTTAAGAGCAACTTTGTTGCTG
rJMSF045O02+ CAGCAGTAAATTCACTAAGAACCGGGATGATGGCACAGTTTAAGAGCAACTTTGTTGCTG
rJMSF022A04+ CAGCAGTAAATTCACTAAGAACCGGGATGATGGCACAGTTTAAGAGCAACTTTGTTGCTG
                      ____________________________________________________________
consensus CAGCAGTAAATTCACTAAGAACCGGGATGATGGCACAGTTTAAGAGCAACTTTGTTGCTG
 
. : . : . : . : . : . :
rJMFF010N09+ CCTCATCAAATCTCCAAAATCAGGCGTTAGGTAATAGTTCAGGAATGAACCCTAACAAGA
rJMFF034C07+ CCTCATCAAATCTCCAAAATCAGGCGTTAGGTAATAGTTCAGGAATGAACCCTAACAAGA
rJMSF009I24+ CCTCATCAAATCTCCAAAATCAGGCGTTAGGTAATAGTTCAGGAATGAACCCTAACAAGA
rJMFF008N07+ CCTCATCAAATCTCCAAAATCAGGCGTTAGGTAATAGTTCAGGAATGAACCCTAACAAGA
rJMFF041A20+ CCTCATCAAATTTCCAAAATCAGGCGTTAGGTAATAGTTCAGGAATGAACCCTAACAAAA
rJMFF014M03+ CCTCATCAAATCTCCAAAATCAGGCGTTAGGTAATAGTTCAGGAATGAACCCTAACAAGA
rJMFF043C04+ CCTCATCAAATCTCCAAAATCAGGCGTTAGGTAATAGTTCAGGAATGAACCCTAACAAGA
rJMSF045O02+ CCTCATCAAATCTCCAAAATCAGGCGTTAGGTAATAGTTCAGGAATGAACCCTAACAAGA
rJMSF022A04+ CCTCATCAAATCTCCAAAATCAGGCGTTAGGTAATAGTTCAGGAATGAACCCTAACAAGA
                      ____________________________________________________________
consensus CCTCATCAAATCTCCAAAATCAGGCGTTAGGTAATAGTTCAGGAATGAACCCTAACAAGA
 
. : . : . : . : . : . :
rJMFF010N09+ AAATGGCACTGCCAGGCTTTGTATCTGGGGGAACAATAGGTGGAGACACAAACGCTTCCC
rJMFF034C07+ AAATGGCACTGCCAGGCTTTGTATCTGGGGGAACAATAGGTGGAGACACAAACGCTTCCC
rJMSF009I24+ AAATGGCACTGCCAGGCTTTGTATCTGGGGGAACAATAGGTGGAGACACAAACGCTTCCC
rJMFF008N07+ AAATGGCACTGCCAGGCTTTGTATCTGGGGGAACAATAGGTGGAGACACAAACGCTTCCC
rJMFF041A20+ AAATGGCCCTGCCAGGCTTTGTATTTGGGGGAACAATAGGTGGAGACACAAACGCTTCCC
rJMFF014M03+ AAATGGCACTGCCAGGCTTTGTATCTGGGGGAACAATAGGTGGAGACACAAACGCTTCCC
rJMFF043C04+ AAATGGCACTGCCAGGCTTTGTATCTGGGGGAACAATAGGTGGAGACACAAACGCTTCCC
rJMSF045O02+ AAATGGCACTGCCAGGCTTTGTATCTGGGGGAACAATAGGTGGAGACACAAACGCTTCCC
rJMSF022A04+ AAATGGCACTGCCAGGCTTTGTATCTGGGGGAACAATAGGTGGAGACACAAACGCTTCCC
                      ____________________________________________________________
consensus AAATGGCACTGCCAGGCTTTGTATCTGGGGGAACAATAGGTGGAGACACAAACGCTTCCC
 
. : . : . : . : . : . :
rJMFF010N09+ GGACTAGTTCAATTAGTAATGCTGCAACATCTGTTCAGAAACCGAGAGAAGATGCTAGCC
rJMFF034C07+ GGACTAGTTCAATTAGTAATGCTGCAACATCTGTTCAGAAACCGAGAGAAGATGCTAGCC
rJMSF009I24+ GGACTAGTTCAATTAGTAATGCTGCAACATCTGTTCAGAAACCGAGAGAAGATGCTAGCC
rJMFF008N07+ GGACTAGTTCAATTAGTAATGCTGCAACATCTGTTCAGAAACCGAGAGAAGATGCTAGCC
rJMFF041A20+ GGACTAGTTCAATTAGTAATGCTGCAACATCTGTTCAAAAACCGAAAAAAAATGCTAGCC
rJMFF014M03+ GGACTAGTTCAATTAGTAATGCTGCAACATCTGTTCAGAAACCGAGAGAAGATGCTAGCC
rJMFF043C04+ GGACTAGTTCAATTAGTAATGCTGCAACATCTGTTCAGAAACCGAGAGAAGATGCTAGCC
rJMSF045O02+ GGACTAGTTCAATTAGTAATGCTGCAACATCTGTTCAGAAACCGAGAGAAGATGCTAGCC
rJMSF022A04+ GGACTAGTTCAATTAGTAATGCTGCAACATCTGTTCAGAAACCGAGAGAAGATGCTAGCC
                      ____________________________________________________________
consensus GGACTAGTTCAATTAGTAATGCTGCAACATCTGTTCAGAAACCGAGAGAAGATGCTAGCC
 
. : . : . : . : . : . :
rJMFF010N09+ ACTTGAGCTCAGGAAGCTCTAGAGATAGGCAGAGAGAAAGGAGGCGGCCTTCTGGTTGGG
rJMFF034C07+ ACTTGAGCTCAGGAAGCTCTAGAGATAGGCAGAGAGAAAGGAGGCGGCCTTCTGGTTGGG
rJMSF009I24+ ACTTGAGCTCAGGAAGCTCTAGAGATAGGCAGAGAGAAAGGAGGCGGCCTTCTGGTTGGG
rJMFF008N07+ ACTTGAGCTCAGGAAGCTCTAGAGATAGGCAGAGAGAAAGGAGGCGGCCTTCTGGTTGGG
rJMFF041A20+ CCTTGAGCTCAGGAAGCTTTAAAGATAGGCAAAAAAAAAGGAGGCGGCCTTTTGGTTGGG
rJMFF014M03+ ACTTGAGCTCAGGAAGCTCTAGAGATAGGCAGAGAGAAAGGAGGCGGCCTTCTGGTTGGG
rJMFF043C04+ ACTTGAGCTCAGGAAGCTCTAGAGATAGGCAGAGAGAAAGGAGGCGGCCTTCTGGTTGGG
rJMSF045O02+ ACTTGAGCTCAGGAAGCTCTAGAGATAGGCAGAGAGAAAGGAGGCGGCCTTCTGGTTGGG
rJMSF022A04+ ACTTGAGCTCAGGAAGCTCTAGAGATAGGCAGAGAGAAAGGAGGCGGCCTTCTGGTTGGG
                      ____________________________________________________________
consensus ACTTGAGCTCAGGAAGCTCTAGAGATAGGCAGAGAGAAAGGAGGCGGCCTTCTGGTTGGG
 
. : . : . : . : . : . :
rJMFF010N09+ ACCGTTGATTTGTTTCTTTGGCAGCTCATTTATATTTATACTGGATGACCAAATCCGCTT
rJMFF034C07+ ACCGTTGATTTGTTTCTTTGGCAGCTCATTTATATTTATACTGGATGACCAAATCCGCTT
rJMSF009I24+ ACCGTTGATTTGTTTCTTTGGCAGCTCATTTATATTTATACTGGATGACCAAATCCGCTT
rJMFF008N07+ ACCGTTGATTTGTTTCTTTGGCAGCTCATTTATATTTATACTGGATGACCAAATCCGCTT
rJMFF041A20+ ACCGTTGATTTGTTTTTTTGGCAGCTCATTTATATTTATACTGGATGACCAAATCCGCTT
rJMFF014M03+ ACCGTTGATTTGTTTCTTTGGCAGCTCATTTATATTTATACTGGATGACCAAATCCGCTT
rJMFF043C04+ ACCGTTGATTTGTTTCTTTGGCAGCTCATTTATATTTATACTGGATGACCAAATCCGCTT
rJMSF045O02+ ACCGTTGATTTGTTTCTTTGGCAGCTCATTTATATTTATACTGGATGACCAAATCCGCTT
rJMSF022A04+ ACCGTTGATTTGTTTCTTTGGCAGCTCATTTATATTTATACTGGATGACCAAATCCGCTT
                      ____________________________________________________________
consensus ACCGTTGATTTGTTTCTTTGGCAGCTCATTTATATTTATACTGGATGACCAAATCCGCTT
 
. : . : . : . : . : . :
rJMFF010N09+ GTGTGAACATGAATAGTCATAATTTAGGTGAAAGTTTTATCTCATTGTCTGTAATGATGC
rJMFF034C07+ GTGTGAACATGAATAGTCATAATTTAGGTGAAAGTTTTATCTCATTGTCTGTAATGATGC
rJMSF009I24+ GTGTGAACTTGAATAGTCATAATTTAGGTGAAAGTTTTATCTCATTGTCTGTAATGATGC
rJMFF008N07+ GTGTGAACTTGAATAGTCATAATTTAGGTGAAAGTTTTATCTCATTGTCTGTAATGATGC
rJMFF041A20+ GTGTGAACTTGAATAGTCATAATTTAGGTGAAAGTTTTATCTCATTGTCTGTAATGAAGC
rJMFF014M03+ GTGTGAACTTGAATAGTCATAATTTAGGTGAAAGTTTTATCTCATTGTCTGTAATGATGC
rJMFF043C04+ GTGTGAACTTGAATAGTCATAATTTAGGTGAAAGTTTTATCTCATTGTCTGTAATGATGC
rJMSF045O02+ GTGTGAACTTGAATAGTCATAATTTAGGTGAAAGTTTTATCTCATTGTCTGTAATGATGC
rJMSF022A04+ GTGTGAACTTGAATAGTCATAATTTAGGTGAAAGTTTTATCTCATTGTCTGTAATGATGC
                      ____________________________________________________________
consensus GTGTGAACTTGAATAGTCATAATTTAGGTGAAAGTTTTATCTCATTGTCTGTAATGATGC
 
. : . : . : . : . : . :
rJMFF010N09+ TCTTTG
rJMFF034C07+ TCTT
rJMSF009I24+ TCTT
rJMFF008N07+ TCTTTG
rJMFF041A20+ TCTTTGCCCAAATTGCTCAT
rJMFF014M03+ TCTTTGCCCAAATTGCTCATCTTGGTTTA
rJMFF043C04+ TCTTTGCCCAAATTGCTCATCTTGGTTTA
rJMSF045O02+ TCTTTGCCCAAATTGCTCATCTTGGTTTATGTGCCCTTGTTCCAATTCTAGTTTGTGGTC
rJMSF022A04+ TCTTTGCCCAAATTGCTCATCTTGGTTTATGTGCCCTTGTTCCAATTCTAGTTTGTGGTC
                      ____________________________________________________________
consensus TCTTTGCCCAAATTGCTCATCTTGGTTTATGTGCCCTTGTTCCAATTCTAGTTTGTGGTC
 
. : . : . : . : . : . :
rJMSF045O02+ TTAATTTTTATTGTATAGATAAATAGATAGATGATATTTATGTGCCCTTGTTCCCACTCC
rJMSF022A04+ TTAATTTTTATTGTATAGATAAATAGATAGATGATATTTATGTGCCCTTGTTCCCACTCC
                      ____________________________________________________________
consensus TTAATTTTTATTGTATAGATAAATAGATAGATGATATTTATGTGCCCTTGTTCCCACTCC
 
. : . : . : . : . : . :
rJMSF045O02+ ATTTAGCCCAGCCTTGCCCCATCCTCTTTTTAAATTACCTCTTATTATATCTGTTGACAT
rJMSF022A04+ ATTTAGCCCAGCCTTGCCCCATCCTCTTTTTAAATTACCTCTTATTATATCTGTTGACAT
                      ____________________________________________________________
consensus ATTTAGCCCAGCCTTGCCCCATCCTCTTTTTAAATTACCTCTTATTATATCTGTTGACAT
 
. : . : . : . : . : . :
rJMSF045O02+ GTCACTCTTGAAGGTGAATGTTTAAGCTAAAATTAAGTAGGAAAATGCCCT
rJMSF022A04+ GTCACTCTTGAAGGTGAATGTTTAAGCTAAAATTAAGTAGGAAAATGCCCTGTACCATTT
                      ____________________________________________________________
consensus GTCACTCTTGAAGGTGAATGTTTAAGCTAAAATTAAGTAGGAAAATGCCCTGTACCATTT