Previous Contig 012227:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMSF003K21Sequence280004539 (6)755012227 (3)gb:BT005961_16388839e-67Arabidopsis thaliana At4g34280 gene, complete cds.>gb:AK117309_1815349 Arabidops
JMSF021P04Sequence670004539 (6)gb:BT005961_16388831e-30Arabidopsis thaliana At4g34280 gene, complete cds.>gb:AK117309_1815349 Arabidops741012227 (3)gb:BT005961_16388834e-61Arabidopsis thaliana At4g34280 gene, complete cds.>gb:AK117309_1815349 Arabidops
JMSF025I01Sequence693004539 (6)gb:BT005961_16388831e-41Arabidopsis thaliana At4g34280 gene, complete cds.>gb:AK117309_1815349 Arabidops802012227 (3)gb:BT005961_16388835e-66Arabidopsis thaliana At4g34280 gene, complete cds.>gb:AK117309_1815349 Arabidops

Alignment

This contig is upended


. : . : . : . : . : . :
rJMSF003K21+ TTGATCAGGATGTTA
rJMSF025I01+ CCATTTTTGCCACTCATCGTTTGATCAGGATGTTA
                      ____________________________________________________________
consensus CCATTTTTGCCACTCATCGTTTGATCAGGATGTTA
 
. : . : . : . : . : . :
rJMSF003K21+ AGCTGTGGATTTGAGACAGAAACCAATCCACCCTTGCTATACTGCTTCAAGCTCTCGCGG
rJMSF025I01+ AGCTGTGGGATTGAGACAGAAACCAATCCACCC-TGCTATACTGCTTCAAGCTCTCGCGG
rJMSF021P04+ TACTGCTTCAAGCTCTCGCGG
                      ____________________________________________________________
consensus AGCTGTGGGTTTGAGACAGAAACCAATCCACCCTTGCTATACTGCTTCAAGCTCTCGCGG
 
. : . : . : . : . : . :
rJMSF003K21+ GAATGTAATGGTTTGCTTTTCTCCAGATGATCACTATCTTCTAGTTTCAGCTGTTGATAA
rJMSF025I01+ GAATGTAATGGTTTGCTTTTCTCCAGATGATCACTATCTTCTAGTTTCAGCTGTTGATAA
rJMSF021P04+ GAATGTAATGGTTTGCTTTTCTCCAGATGATCACTATCTTCTAGTTTCAGCTGTTGATAA
                      ____________________________________________________________
consensus GAATGTAATGGTTTGCTTTTCTCCAGATGATCACTATCTTCTAGTTTCAGCTGTTGATAA
 
. : . : . : . : . : . :
rJMSF003K21+ TGAGGTGAAACAACTATTGGCTGTTGATGGAAGGCTTCACTTGGATTTTGGTATTGCTTC
rJMSF025I01+ TGAGGTGAAACAACTATTGGCTGTTGATGGAAGGCTTCACTTGGATTTTGGTATTGCTTC
rJMSF021P04+ TGAGGTGAAACAACTATTGGCTGTTGATGGAAGGCTTCACTTGGATTTTGGTATTGCTTC
                      ____________________________________________________________
consensus TGAGGTGAAACAACTATTGGCTGTTGATGGAAGGCTTCACTTGGATTTTGGTATTGCTTC
 
. : . : . : . : . : . :
rJMSF003K21+ AACTGGCAGTTCACAGAATTACACTCGATCTTATTACATGAATGGGAGAGATTATGTTAT
rJMSF025I01+ AACTGGCAGTTCACAGAATTACACTCGATCTTATTACATGAATGGGAGAGATTATGTTAT
rJMSF021P04+ AACTGGCAGTTCACAGAATTACACTCGATCTTATTACATGAATGGGAGAGATTATGTTAT
                      ____________________________________________________________
consensus AACTGGCAGTTCACAGAATTACACTCGATCTTATTACATGAATGGGAGAGATTATGTTAT
 
. : . : . : . : . : . :
rJMSF003K21+ CAGTGGAAGTTGTGATGAGCATGTCATTCGTATCTGCTGTGCTCAAACGGGGAGGCGACT
rJMSF025I01+ CAGTGGAAGTTGTGATGAGCATGTCATTCGTATCTGCTGTGCTCAAACGGGGAGGCGACT
rJMSF021P04+ CAGTGGAAGTTGTGATGAGCATGTCATTCGTATCTGCTGTGCTCAAACGGGGAGGCGACT
                      ____________________________________________________________
consensus CAGTGGAAGTTGTGATGAGCATGTCATTCGTATCTGCTGTGCTCAAACGGGGAGGCGACT
 
. : . : . : . : . : . :
rJMSF003K21+ TAGGGATGTATCGTTGGAGGGAAAAGGTTCAGGAGCATCTATGTTTGTTCAATCTTTGAG
rJMSF025I01+ TAGGGATGTATCGTTGGAGGGAAAAGGTTCAGGAGCATCTATGTTTGTTCAATCTTTGAG
rJMSF021P04+ TAGGGATGTATCGTTGGAGGGAAAAGGTTCAGGAGCATCTATGTTTGTTCAATCTTTGAG
                      ____________________________________________________________
consensus TAGGGATGTATCGTTGGAGGGAAAAGGTTCAGGAGCATCTATGTTTGTTCAATCTTTGAG
 
. : . : . : . : . : . :
rJMSF003K21+ GGGTGACCCTTTCAGAGACTTCAACATGAGCTTCTTAGCAGCCTATACGCGTCCAAGTTC
rJMSF025I01+ GGGTGACCCTTTCAGAGACTTCAACATGAGCTTCTTAGCAGCCTATACGCGTCCAAGTTC
rJMSF021P04+ GGGTGACCCTTTCAGAGACTTCAACATGAGCTTCTTAGCAGCCTATACGCGTCCAAGTTC
                      ____________________________________________________________
consensus GGGTGACCCTTTCAGAGACTTCAACATGAGCTTCTTAGCAGCCTATACGCGTCCAAGTTC
 
. : . : . : . : . : . :
rJMSF003K21+ AGTTTCAGAAATTGTTAAGGTGAATCTGTTGGCATCCAATGACCAATATAGAGTTCGTTC
rJMSF025I01+ AGTTTCAGAAATTGTTAAGGTGAATCTGTTGGCATCCAATGACCAATATAGAGTTCGTTC
rJMSF021P04+ AGTTTCAGAAATTGTTAAGGTGAATCTGTTGGCATCCAATGACCAATATAGAGTTCGTTC
                      ____________________________________________________________
consensus AGTTTCAGAAATTGTTAAGGTGAATCTGTTGGCATCCAATGACCAATATAGAGTTCGTTC
 
. : . : . : . : . : . :
rJMSF003K21+ ACACCATAACCATCCCCATCCATCATTTGGTAGTGGAGGTTAACATAGTTGCTGCAATTC
rJMSF025I01+ ACACCATAACCATCCCCATCCATCATTTGGTAGTGGAGGTTAACATAGTTGCTGCAATTC
rJMSF021P04+ ACACCATAACCATCCCCATCCATCATTTGGTAGTGGAGGTTAACATAGTTGCTGCAATTC
                      ____________________________________________________________
consensus ACACCATAACCATCCCCATCCATCATTTGGTAGTGGAGGTTAACATAGTTGCTGCAATTC
 
. : . : . : . : . : . :
rJMSF003K21+ CCATGTACAAACTATATATATCCATATTCCTCATTTGCGCCAAATTATGTCAGAAATGAT
rJMSF025I01+ CCATGTACAAACTATATATATCCATATTCCTCATTTGCGCCAAATTATGTCAGAAATGAT
rJMSF021P04+ CCATGTACAAACTATATATATCCATATTCCTCATTTGCGCCAAATTATGTCAGAAATGAT
                      ____________________________________________________________
consensus CCATGTACAAACTATATATATCCATATTCCTCATTTGCGCCAAATTATGTCAGAAATGAT
 
. : . : . : . : . : . :
rJMSF003K21+ GTGGCTTGTCATAAATGTTTATCGTATTTATCAACTATTCGATAAAGCTGTGTCGTTTTG
rJMSF025I01+ GTGGCTTGTCATAAATGTTTATCGTATTTATCAACTATTCGATAAAGCTGTGTCGTTTTG
rJMSF021P04+ GTGGCTTGTCATAAATGTTTATCGTATTTATCAACTATTCGATAAAGCTGTGTCGTTTTG
                      ____________________________________________________________
consensus GTGGCTTGTCATAAATGTTTATCGTATTTATCAACTATTCGATAAAGCTGTGTCGTTTTG
 
. : . : . : . : . : . :
rJMSF003K21+ GACAAAGTTTGGTGCAAAATAGAGGAAATATATATAGTATTATTGCTTGCTTAGTTGCGC
rJMSF025I01+ GACAAAGTTTGGTGCAAAATAGAGGAAATATATATAGTATTATTGCTTGCTTAGTTGCGC
rJMSF021P04+ GACAAAGTTTGGTGCAAAATAGAGGAAATATATATAGTATTATTGCTTGCTTAGTTGCGC
                      ____________________________________________________________
consensus GACAAAGTTTGGTGCAAAATAGAGGAAATATATATAGTATTATTGCTTGCTTAGTTGCGC
 
. : . : . : . : . : . :
rJMSF003K21+ TTGTAAATATAGTA
rJMSF025I01+ TTGTAAATATAGTAGTATATCATAATAAGAAAATAATGATGTAT
rJMSF021P04+ TTGTAAATATAGTAGTATATCATAATAAGAAAATAATGATGTATTGATATTGTCTACCAA
                      ____________________________________________________________
consensus TTGTAAATATAGTAGTATATCATAATAAGAAAATAATGATGTATTGATATTGTCTACCAA