Previous Contig 012224:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMSF016L15Sequence512006122 (3)gb:AY087343_15723754e-17Arabidopsis thaliana clone 34418 mRNA, complete sequence.787012224 (3)gb:AP004774_18448345e-52Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, PAC clone:P043
JMSF021N12Sequence652006122 (3)gb:AY087343_15723756e-42Arabidopsis thaliana clone 34418 mRNA, complete sequence.742012224 (3)gb:AP004774_18448347e-42Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, PAC clone:P043
JMSF023C07Sequence655006122 (3)gb:AY087343_15723751e-42Arabidopsis thaliana clone 34418 mRNA, complete sequence.810012224 (3)gb:AP004774_18448343e-55Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, PAC clone:P043

Alignment

This contig is upended


. : . : . : . : . : . :
rJMSF023C07+ ACTTAAGTNCAGAAAATAGGAGGAGAAAAGCTGTAGAAGAACTAGTACGCAT
rJMSF016L15+ AAGCTGTAGAAGAACTAGTACGCAT
                      ____________________________________________________________
consensus ACTTAAGTNCAGAAAATAGGAGGAGAAAAGCTGTAGAAGAACTAGTACGCAT
 
. : . : . : . : . : . :
rJMSF023C07+ AGTTAAAAAGGGAGGCTTTGTATTGATTACAGTTTGGGCTAGGGAACAGGAAGATGGATC
rJMSF016L15+ AGTTAAAAAGGGAGGCTTTGTATTGATTACAGTTTGGGCTAGGGAACAGGAAGATGGATC
rJMSF021N12+ CTAGGGAACAGGAAGATGGATC
                      ____________________________________________________________
consensus AGTTAAAAAGGGAGGCTTTGTATTGATTACAGTTTGGGCTAGGGAACAGGAAGATGGATC
 
. : . : . : . : . : . :
rJMSF023C07+ ATTGGTTAACAAATGGACACCACTTACAGAGAAGTATTTGGAGGAATGGGTAGCACCAAG
rJMSF016L15+ ATTGGTTAACAAATGGACACCACTTACAGAGAAGTATTTGGAGGAATGGGTAGCACCAAG
rJMSF021N12+ ATTGGTTAACAAATGGACACCACTTACAGAGAAGTATTTGGAGGAATGGGTAGCACCAAG
                      ____________________________________________________________
consensus ATTGGTTAACAAATGGACACCACTTACAGAGAAGTATTTGGAGGAATGGGTAGCACCAAG
 
. : . : . : . : . : . :
rJMSF023C07+ CAGTCCTCGGATTCGCAATCCTTCCTCTCCTCGGACTCTAGCAAGCATCCCGGAGACTGA
rJMSF016L15+ CAGTCCTCGGATTCGCAATCCTTCCTCTCCTCGGACTCTAGCAAGCATCCCGGAGACTGA
rJMSF021N12+ CAGTCCTCGGATTCGCAATCCTTCCTCTCCTCGGACTCTAGCAAGCATCCCGGAGACTGA
                      ____________________________________________________________
consensus CAGTCCTCGGATTCGCAATCCTTCCTCTCCTCGGACTCTAGCAAGCATCCCGGAGACTGA
 
. : . : . : . : . : . :
rJMSF023C07+ GGAAAATGGCTCGGGAGTGAATAAATCAGCTGAAATTTCACATTCAGCAGTTCATGATAG
rJMSF016L15+ GGAAAATGGCTCGGGAGTGAATAAATCAGCTGAAATTTCACATTCAGCAGTTCATGATAG
rJMSF021N12+ GGAAAATGGCTCGGGAGTGAATAAATCAGCTGAAATTTCACATTCAGCAGTTCATGATAG
                      ____________________________________________________________
consensus GGAAAATGGCTCGGGAGTGAATAAATCAGCTGAAATTTCACATTCAGCAGTTCATGATAG
 
. : . : . : . : . : . :
rJMSF023C07+ AGGTCATTTGGATTCTGGAATTGAAAATGCTTCTATAGAGCAACAGGAATACTTTGTTCC
rJMSF016L15+ AGGTCATTTGGATTCTGGAATTGAAAATGCTTCTATAGAGCAACAGGAATACTTTGTTCC
rJMSF021N12+ AGGTCATTTGGATTCTGGAATTGAAAATGCTTCTATAGAGCAACAGGAATACTTTGTTCC
                      ____________________________________________________________
consensus AGGTCATTTGGATTCTGGAATTGAAAATGCTTCTATAGAGCAACAGGAATACTTTGTTCC
 
. : . : . : . : . : . :
rJMSF023C07+ TTGGCATTTACCTTATCATAGAGCTGAAGTAAGCGGGGCTTCTGCTTGTGCCCTCGCAAG
rJMSF016L15+ TTGGCATTTACCTTATCATAGAGCTGAAGTAAGCGGGGCTTCTGCTTGTGCCCTCGCAAG
rJMSF021N12+ TTGGCATTTACCTTATCATAGAGCTGAAGTAAGCGGGGCTTCTGCTTGTGCCCTCGCAAG
                      ____________________________________________________________
consensus TTGGCATTTACCTTATCATAGAGCTGAAGTAAGCGGGGCTTCTGCTTGTGCCCTCGCAAG
 
. : . : . : . : . : . :
rJMSF023C07+ TGGCCTGGCAAAGAAAGATGATAAAAAGGGTGCAGTTGTGTATAACAGATATTACCATGT
rJMSF016L15+ TGGCCTGGCAAAGAAAGATGATAAAAAGGGTGCAGTTGTGTATAACAGATATTACCATGT
rJMSF021N12+ TGGCCTGGCAAAGAAAGATGATAAAAAGGGTGCAGTTGTGTATAACAGATATTACCATGT
                      ____________________________________________________________
consensus TGGCCTGGCAAAGAAAGATGATAAAAAGGGTGCAGTTGTGTATAACAGATATTACCATGT
 
. : . : . : . : . : . :
rJMSF023C07+ TTTTAGTGAAGGTGAACTAGAAAGGTTGGTGTCTGGTTTGGATAATGCAGTCATTGTTGA
rJMSF016L15+ TTTTAGTGAAGGTGAACTAGAAAGGTTGGTGTCTGGTTTGGATAATGCAGTCATTGTTGA
rJMSF021N12+ TTTTAGTGAAGGTGAACTAGAAAGGTTGGTGTCTGGTTTGGATAATGCAGTCATTGTTGA
                      ____________________________________________________________
consensus TTTTAGTGAAGGTGAACTAGAAAGGTTGGTGTCTGGTTTGGATAATGCAGTCATTGTTGA
 
. : . : . : . : . : . :
rJMSF023C07+ TAGATTCTATGATAAATCAAATTGGTGCATCATACTCGAGAAGACATCCTGATAAAGTGA
rJMSF016L15+ TAGATTCTATGATAAATCAAATTGGTGCATCATACTCGAGAAGACATCCTGATAAAGTGA
rJMSF021N12+ TAGATTCTATGATAAATCAAATTGGTGCATCATACTCGAGAAGACATCCTGATAAAGTGA
                      ____________________________________________________________
consensus TAGATTCTATGATAAATCAAATTGGTGCATCATACTCGAGAAGACATCCTGATAAAGTGA
 
. : . : . : . : . : . :
rJMSF023C07+ CACCATAAAATACGATGACAATAAGACTACATAGATGTGTTCCGAGATTAGGGTGATTGA
rJMSF016L15+ CACCATAAAATACGATGACAATAAGACTACATAGATGTGTTCCGAGATTAGGGTGATTGA
rJMSF021N12+ CACCATAAAATACGATGACAATAAGACTACATAGATGTGTTCCGAGATTAGGGTGATTGA
                      ____________________________________________________________
consensus CACCATAAAATACGATGACAATAAGACTACATAGATGTGTTCCGAGATTAGGGTGATTGA
 
. : . : . : . : . : . :
rJMSF023C07+ ACATCGTGCTAATCTTTGCTGGGGTTGAGAAGTCATTGCAGGCTTTTCAACCAAGACCAG
rJMSF016L15+ ACATCGTGCTAATCTTTGCTGGGGTTGAGAAGTCATTGCAGGCTTTTCAACCAAGACCAG
rJMSF021N12+ ACATCGTGCTAATCTTTGCTGGGGTTGAGAAGTCATTGCAGGCTTTTCAACCAAGACCAG
                      ____________________________________________________________
consensus ACATCGTGCTAATCTTTGCTGGGGTTGAGAAGTCATTGCAGGCTTTTCAACCAAGACCAG
 
. : . : . : . : . : . :
rJMSF023C07+ CACATCCATACATTAGTCAATAAAACTACTGAAGGGGAGCTCTTTTTCTTATGGGAGACT
rJMSF016L15+ CACATCCATACATTAGTCAATAAAACTACTGAAGGGGAGCTCTTTTTCTTATGGGAGACT
rJMSF021N12+ CACATCCATACATTAGTCAATAAAACTACTGAAGGGGAGCTCTTTTTCTTATGGGAGACT
                      ____________________________________________________________
consensus CACATCCATACATTAGTCAATAAAACTACTGAAGGGGAGCTCTTTTTCTTATGGGAGACT
 
. : . : . : . : . : . :
rJMSF023C07+ TCTTTTATGCTTCTCTCCTTGCCTGTAATGTCTGAATG
rJMSF016L15+ TCTTTTATGCTTCTCTCCTTGCCTGTAATGTCTGAATG
rJMSF021N12+ TCTTTTATGCTTCTCTCCTTGCCTGTAATGTCTGAATGTACACTTCTCCCTCTTGTGATT
                      ____________________________________________________________
consensus TCTTTTATGCTTCTCTCCTTGCCTGTAATGTCTGAATGTACACTTCTCCCTCTTGTGATT