Previous Contig 012221:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMSF021N07Sequence700012221 (6)pir|E86411|E864112e-40protein F1K23.18 [imported] - Arabidopsis thaliana>gb:AE005172_891744 Arabidopsi779012221 (6)pir|F86411|F864118e-39pnrotein F1K23.16 [imported] - Arabidopsis thaliana>gb:AE005172_891746 Arabidops
JMSF038F13Sequence693012221 (6)pir|E86411|E864112e-40protein F1K23.18 [imported] - Arabidopsis thaliana>gb:AE005172_891744 Arabidopsi923012221 (6)pir|E86411|E864113e-63protein F1K23.18 [imported] - Arabidopsis thaliana>gb:AE005172_891744 Arabidopsi
JMSF048B02Sequence693012221 (6)pir|E86411|E864112e-40protein F1K23.18 [imported] - Arabidopsis thaliana>gb:AE005172_891744 Arabidopsi782012221 (6)pir|E86411|E864112e-57protein F1K23.18 [imported] - Arabidopsis thaliana>gb:AE005172_891744 Arabidopsi

Alignment

This contig is upended


. : . : . : . : . : . :
JMSF048B02- TAGTATTATCATACATTTACTTCTAT
JMSF038F13- TAGTATTATCATACATTTACTTCTAT
JMSF021N07- TGAGGTATAGTATTATCATACATTTACTTCTAT
                      ____________________________________________________________
consensus TGAGGTATAGTATTATCATACATTTACTTCTAT
 
. : . : . : . : . : . :
JMSF048B02- TCCCAGATGGCGTTGAAATTCATTTCCACTATATTCCTCCTAATATTCATAATTCCAAGA
JMSF038F13- TCCCAGATGGCGTTGAAATTCATTTCCACTATATTCCTCCTAATATTCATAATTCCAAGA
JMSF021N07- TCCCAGATGGCGTTGAAATTCATTTCCACTATATTCCTCCTAATATTCATAATTCCAAGA
                      ____________________________________________________________
consensus TCCCAGATGGCGTTGAAATTCATTTCCACTATATTCCTCCTAATATTCATAATTCCAAGA
 
. : . : . : . : . : . :
JMSF048B02- AGCAAAACCTTAGCATGCTACACATCCATCTTTGCATTTGGTGACTCTCTTACAGATGCG
JMSF038F13- AGCAAAACCTTAGCATGCTACACATCCATCTTTGCATTTGGTGACTCTCTTACAGATGCG
JMSF021N07- AGCAAAACCTTAGCATGCTACACATCCATCTTTGCATTTGGTGACTCTCTTACAGATGCG
                      ____________________________________________________________
consensus AGCAAAACCTTAGCATGCTACACATCCATCTTTGCATTTGGTGACTCTCTTACAGATGCG
 
. : . : . : . : . : . :
JMSF048B02- GGCAATAGGATTTTCTTCTCCCATGACCTTTCCAACCTGAACGTGGCCAATCCTCCTTAT
JMSF038F13- GGCAATAGGATTTTCTTCTCCCATGACCTTTCCAACCTGAACGTGGCCAATCCTCCTTAT
JMSF021N07- GGCAATAGGATTTTCTTCTCCCATGACCTTTCCAACCTGAACGTGGCCAATCCTCCTTAT
                      ____________________________________________________________
consensus GGCAATAGGATTTTCTTCTCCCATGACCTTTCCAACCTGAACGTGGCCAATCCTCCTTAT
 
. : . : . : . : . : . :
JMSF048B02- GGAGAAACCTTCTTTCATTATCCCAACGGTCGCTTTTGCGATGGTCGTATCATAATTGAT
JMSF038F13- GGAGAAACCTTCTTTCATTATCCCAACGGTCGCTTTTGCGATGGTCGTATCATAATTGAT
JMSF021N07- GGAGAAACCTTCTTTCATTATCCCAACGGTCGCTTTTGCGATGGTCGTATCATAATTGAT
                      ____________________________________________________________
consensus GGAGAAACCTTCTTTCATTATCCCAACGGTCGCTTTTGCGATGGTCGTATCATAATTGAT
 
. : . : . : . : . : . :
JMSF048B02- TTTATAGCGGAGCATTATGGAGTGGCGTTTATGCCTCCATCAGCTAGTGTTGCCGGAAAC
JMSF038F13- TTTATAGCGGAGCATTATGGAGTGGCGTTTATGCCTCCATCAGCTAGTGTTGCCGGAAAC
JMSF021N07- TTTATAGCGGAGCATTATGGAGTGGCGTTTATGCCTCCATCAGCTAGTGTTGCCGGAAAC
rJMSF038F13+ GGCGTTTATGCCTCCATCAGCTAGTGTTGCCGGAAAC
                      ____________________________________________________________
consensus TTTATAGCGGAGCATTATGGAGTGGCGTTTATGCCTCCATCAGCTAGTGTTGCCGGAAAC
 
. : . : . : . : . : . :
JMSF048B02- GGGTCAAGTATTGAAGGAGGTGTGAA-TTTCGCGGTTGGCGGAGCTGCTGCGGTGGACTC
JMSF038F13- GGGTCAAGTATTGAAGGAGGTGTGAA-TTTCGCGGTTGGCGGAGCTGCTGCGGTGGACTC
JMSF021N07- GGGTCAAGTATTGAAGGAGGTGTGAA-TTTCGCGGTTGGCGGAGCTGCTGCGGTGGACTC
rJMSF038F13+ GGGTCAAGTATTGAAGGAGGTGTGAATTTTCGCGGTTGGCGGAGCTGCTGCGGTGGACTC
                      ____________________________________________________________
consensus GGGTCAAGTATTGAAGGAGGTGTGAA-TTTCGCGGTTGGCGGAGCTGCTGCGGTGGACTC
 
. : . : . : . : . : . :
JMSF048B02- GGCGTTCTATGAATCAAGAGGAATAATTAATCCCTTTACAAACGCCTCCCTCAACGTCCA
JMSF038F13- GGCGTTCTATGAATCAAGAGGAATAATTAATCCCTTTACAAACGCCTCCCTCAACGTCCA
JMSF021N07- GGCGTTCTATGAATCAAGAGGAATAATTAATCCCTTTACAAACGCCTCCCTCAACGTCCA
rJMSF038F13+ GGCGTTCTATGAATCAAGAGGAATAATTAATCCCTTTACAAACGCCTCCCTCAACGTCCA
rJMSF048B02+ GTCCA
                      ____________________________________________________________
consensus GGCGTTCTATGAATCAAGAGGAATAATTAATCCCTTTACAAACGCCTCCCTCAACGTCCA
 
. : . : . : . : . : . :
JMSF048B02- AATGATATGGTTCAAAGATGTTTTGCCATTGTTCTGTGACACACCCTCAGAATGTAGGAA
JMSF038F13- AATGATATGGTTCAAAGATGTTTTGCCATTGTTCTGTGACACACCCTCAGAATGTAGGAA
JMSF021N07- AATGATATGGTTCAAAGATGTTTTGCCATTGTTCTGTGACACACCCTCAGAATGTAGGAA
rJMSF038F13+ AATGATATGGTTCAAAGATGTTTTGCCATTGTTCTGTGACACACCCTCAGAATGTAGGAA
rJMSF048B02+ AATGATATGGTTCAAAGATGTTTTGCCATTGTTCTGTGACACACCCTCAGAATGTAGGAA
                      ____________________________________________________________
consensus AATGATATGGTTCAAAGATGTTTTGCCATTGTTCTGTGACACACCCTCAGAATGTAGGAA
 
. : . : . : . : . : . :
JMSF048B02- AAAATTTAAAAACTCCCTCTTTGTAGTGGGGCCTTTTGGAAGTAATGACTATCGCCATGC
JMSF038F13- AAAATTTAAAAACTCCCTCTTTGTAGTGGGGCCTTTTGGAAGTAATGACTATCGCCATGC
JMSF021N07- AAAATTTAAAAACTCCCTCTTTGTAGTGGGGCCTTTTGGAAGTAATGACTATCGCCATGC
rJMSF038F13+ AAAATTTAAAAACTCCCTCTTTGTAGTGGGGCCTTTTGGAAGTAATGACTATCGCCATGC
rJMSF048B02+ AAAATTTAAAAACTCCCTCTTTGTAGTGGGGCCTTTTGGAAGTAATGACTATCGCCATGC
                      ____________________________________________________________
consensus AAAATTTAAAAACTCCCTCTTTGTAGTGGGGCCTTTTGGAAGTAATGACTATCGCCATGC
 
. : . : . : . : . : . :
JMSF048B02- ACTTACCTTTGAAAAAGACATCGAAGAGATAAGAACATACATTCCTATGGTTATTGATAC
JMSF038F13- ACTTACCTTTGAAAAAGACATCGAAGAGATAAGAACATACATTCCTATGGTTATTGATAC
JMSF021N07- ACTTACCTTTGAAAAAGACATCGAAGAGATAAGAACATACATTCCTATGGTTATTGATAC
rJMSF038F13+ ACTTACCTTTGAAAAAGACATCGAAGAGATAAGAACATACATTCCTATGGTTATTGATAC
rJMSF048B02+ ACTTACCTTTGAAAAAGACATCGAAGAGATAAGAACATACATTCCTATGGTTATTGATAC
                      ____________________________________________________________
consensus ACTTACCTTTGAAAAAGACATCGAAGAGATAAGAACATACATTCCTATGGTTATTGATAC
 
. : . : . : . : . : . :
JMSF048B02- CATCACAGCAGCAATAAATGATTTGATTAAACTTGGTGCAACGACAATCATGGTACCTAG
JMSF038F13- CATCACAGCAGCAATAAATGATTTGATTAAACTTGGTGCAACGACNATCATGGTACCTAG
JMSF021N07- CATCACAGCAGCAATAAATGATTTGATTAAACTTGGTGCAACGACAATCATGGTACCTAG
rJMSF038F13+ CATCACAGCAGCAATAAATGATTTGATTAAACTTGGTGCAACGACAATCATGGTACCTAG
rJMSF048B02+ CATCACAGCAGCAATAAATGATTTGATTAAACTTGGTGCAACGACAATCATGGTACCTAG
rJMSF021N07+ TCACAGCAGCNATAAATGA-TTGATTAAACTTGGTGCAACGACAATCATGGTACCTAG
                      ____________________________________________________________
consensus CATCACAGCAGCAATAAATGATTTGATTAAACTTGGTGCAACGACAATCATGGTACCTAG
 
. : . : . : . : . : . :
JMSF048B02- CTTATC
JMSF038F13- CTTATC
JMSF021N07- CTTATCTC
rJMSF038F13+ CTTATCTCCAGATGGTTGTCTTCCCGTCATTCTCACAGATTTTGGAAGTGCCAACACTTC
rJMSF048B02+ CTTATCTCCAGATGGTTGTCTTCCCGTCATTCTCACAGATTTTGGAAGTGCCAACACTTC
rJMSF021N07+ CTTATCTCCAGATGGTTGTCTTCCCGTCATTCTCACAGATTTTGGAAGTGCCAACACTTC
                      ____________________________________________________________
consensus CTTATCTCCAGATGGTTGTCTTCCCGTCATTCTCACAGATTTTGGAAGTGCCAACACTTC
 
. : . : . : . : . : . :
rJMSF038F13+ AGATTATGATCCTGATACTGGTTGCCTTTCTTGGTTAAATGAATTGAACGAGTTCCACAA
rJMSF048B02+ AGATTATGATCCTGATACTGGTTGCCTTTCTTGGTTAAATGAATTGAACGAGTTCCACAA
rJMSF021N07+ AGATTATGATCCTGATACTGGTTGCCTTTCTTGGTTAAATGAATTGAACGAGTTCCACAA
                      ____________________________________________________________
consensus AGATTATGATCCTGATACTGGTTGCCTTTCTTGGTTAAATGAATTGAACGAGTTCCACAA
 
. : . : . : . : . : . :
rJMSF038F13+ TCAACGTCTTCAGAAACGACTCCACATCATCCGTCGTCTTAATCCTGACGTTGTCATTAT
rJMSF048B02+ TCAACGTCTTCAGAAACGACTCCACATCATCCGTCGTCTTAATCCTGACGTTGTCATTAT
rJMSF021N07+ TCAACGTCTTCAGAAACGACTCCACATCATCCGTCGTCTTAATCCTGACGTTGTCATTAT
                      ____________________________________________________________
consensus TCAACGTCTTCAGAAACGACTCCACATCATCCGTCGTCTTAATCCTGACGTTGTCATTAT
 
. : . : . : . : . : . :
rJMSF038F13+ CTATGCTGATTTTTACAATGCTGTCATGAAACTTTATCGTAATCCTGGGAAATATGGATT
rJMSF048B02+ CTATGCTGATTTTTACAATGCTGTCATGAAACTTTATCGTAATCCTGGGAAATATGGATT
rJMSF021N07+ CTATGCTGATTTTTACAATGCTGTCATGAAACTTTATCGTAATCCTGGGAAATATGGATT
                      ____________________________________________________________
consensus CTATGCTGATTTTTACAATGCTGTCATGAAACTTTATCGTAATCCTGGGAAATATGGATT
 
. : . : . : . : . : . :
rJMSF038F13+ CTTGCACTCCCTTGAGGCTTGTTGTGGAGCAGGAGGGGCGTATAGATACAATGACGACGT
rJMSF048B02+ CTTGCACTCCCTTGAGGCTTGTTGTGGAGCAGGAGGGGCGTATAGATACAATGACGACGT
rJMSF021N07+ CTTGCACTCCCTTGAGGCTTGTTGTGGAGCAGGAGGGGCGTATAGATACAATGACGACGT
                      ____________________________________________________________
consensus CTTGCACTCCCTTGAGGCTTGTTGTGGAGCAGGAGGGGCGTATAGATACAATGACGACGT
 
. : . : . : . : . : . :
rJMSF038F13+ AAAATGTGGTAATATAAAATTAAAAAATAGTTGTCCTGATCCATGGCATTATATTGATTG
rJMSF048B02+ AAAATGTGGTAATATAAAATTAAAAAATAGTTGTCCTGATCCATGGCATTATATTGATTG
rJMSF021N07+ AAAATGTGGTAATATAAAATTAAAAAATAGTTGTCCTGATCCATGGCATTATATTGATTG
                      ____________________________________________________________
consensus AAAATGTGGTAATATAAAATTAAAAAATAGTTGTCCTGATCCATGGCATTATATTGATTG
 
. : . : . : . : . : . :
rJMSF038F13+ GGACGGAAATCACATGACAGAAAAAGCAAATAGATTGGTTACCATGACTTTACTAGATGG
rJMSF048B02+ GGACGGAAATCACATGACAGAAAAAGCAAATAGATTGGTTACCATGACTTTACTAGATGG
rJMSF021N07+ GGACGGAAATCACATGACAGAAAAAGCAAATAGATTGGTTACCATGACTTTACTAGATGG
                      ____________________________________________________________
consensus GGACGGAAATCACATGACAGAAAAAGCAAATAGATTGGTTACCATGACTTTACTAGATGG
 
. : . : . : . : . : . :
rJMSF038F13+ AACTTATACGAGTCCGTCAATGAATACCTTATGTGCTTCTTCTCCCAAATTCACCTATTA
rJMSF048B02+ AACTTATACGAGTCCGTCAATGAATACCTTATGTGCTTCTTCTCCCAAATTCACCTATTA
rJMSF021N07+ AACTTATACGAGTCCGTCAATGAATACCTTATGTGCTTCTTCTCCCAAATTCACCTATTA
                      ____________________________________________________________
consensus AACTTATACGAGTCCGTCAATGAATACCTTATGTGCTTCTTCTCCCAAATTCACCTATTA
 
. : . : . : . : . : . :
rJMSF038F13+ TGATTAAGAATATTTTGTAATTCATTGGTAACTCCGCCAAGCTCGT
rJMSF048B02+ TGATTAAGAATATTTTGTAATTCATTGGTAACTCCGCCAAGCTCGTATATAGAGCTG
rJMSF021N07+ TGATTAAGAATATTTTGTAATTCATTGGTAACTCCGCCAAGCTCGTATATAGAGCTGGTC
                      ____________________________________________________________
consensus TGATTAAGAATATTTTGTAATTCATTGGTAACTCCGCCAAGCTCGTATATAGAGCTGGTC
 
. : . : . : . : . : . :
rJMSF021N07+ ATCCTAATAAAATTTGAGGAATGTGGTCCCCCAAAAAAACTACAAAATCATTTTCTTAAA
                      ____________________________________________________________
consensus ATCCTAATAAAATTTGAGGAATGTGGTCCCCCAAAAAAACTACAAAATCATTTTCTTAAA
 
. : . : . : . : . : . :
rJMSF021N07+ TCTTATGTATGTTTTCATGAAATAAACAATTTTATGGTTTGGTCGGAAGAAATTATAATT
                      ____________________________________________________________
consensus TCTTATGTATGTTTTCATGAAATAAACAATTTTATGGTTTGGTCGGAAGAAATTATAATT
 
. : . : . : . : . : . :
rJMSF021N07+ CCTTCCAATCACGGATTGTAATTTTAATTTGAATTATTATTTTGCTATTATTATTATTAT
                      ____________________________________________________________
consensus CCTTCCAATCACGGATTGTAATTTTAATTTGAATTATTATTTTGCTATTATTATTATTAT