Previous Contig 012218:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMSF021M17Sequence621003209 (5)sp|P37272|PSY_CAPAN6e-04Phytoene synthase, chloroplast precursor (EC 2.5.1.-).>gb:CAPSY1_1645111 C.annuu776012218 (5)pir|A49558|A49558e-100phytoene synthase 2 precursor - tomato (fragment)
JMSF024J21Sequence645003209 (5)sp|P37272|PSY_CAPAN7e-13Phytoene synthase, chloroplast precursor (EC 2.5.1.-).>gb:CAPSY1_1645111 C.annuu791012218 (5)pir|A49558|A49558e-121phytoene synthase 2 precursor - tomato (fragment)
JMSF038P07Sequence621003209 (5)sp|P37272|PSY_CAPAN6e-04Phytoene synthase, chloroplast precursor (EC 2.5.1.-).>gb:CAPSY1_1645111 C.annuu907012218 (5)pir|A49558|A49558e-138phytoene synthase 2 precursor - tomato (fragment)
JMSF046N03Sequence498012218 (5)pir|A49558|A495584e-53phytoene synthase 2 precursor - tomato (fragment)430012218 (5)pir|A49558|A495583e-53phytoene synthase 2 precursor - tomato (fragment)

Alignment

This contig is upended


. : . : . : . : . : . :
rJMSF038P07+ CTAATGACACCTGAGAGAAGAAGAGCTATC
                      ____________________________________________________________
consensus CTAATGACACCTGAGAGAAGAAGAGCTATC
 
. : . : . : . : . : . :
rJMSF038P07+ TGGGCGATTTATGTGTGGTGTAGGAGAACTGATGAACTTGTTGATGGGCCNTAATGCATC
                      ____________________________________________________________
consensus TGGGCGATTTATGTGTGGTGTAGGAGAACTGATGAACTTGTTGATGGGCCNTAATGCATC
 
. : . : . : . : . : . :
rJMSF024J21+ GATAGATGGGAGGATCGGCTGGAAGACGTATTCAGAGG
rJMSF038P07+ GCATATAACTCCAAAGGCCCTGGATAGATGGGAGGATCGGCTGGAAGACGTATTCAGAGG
                      ____________________________________________________________
consensus GCATATAACTCCAAAGGCCCTGGATAGATGGGAGGATCGGCTGGAAGACGTATTCAGAGG
 
. : . : . : . : . : . :
rJMSF024J21+ GTGCCCGTTTGATATGCTTGACGCTGCACTATCAGATACAGTATCCAGGTTTCCAGTTGA
rJMSF038P07+ GTGCCCGTTTGATATGCTTGACGCTGCACTATCAGATACAGTATCCAGGTTTCCAGTTGA
                      ____________________________________________________________
consensus GTGCCCGTTTGATATGCTTGACGCTGCACTATCAGATACAGTATCCAGGTTTCCAGTTGA
 
. : . : . : . : . : . :
rJMSF024J21+ TATTCAGCCCTTTAGGGATATGATTGAAGGAATGCGAATGGACCTCTGGAAGTCGAGATA
rJMSF038P07+ TATTCAGCCCTTTAGGGATATGATTGAAGGAATGCGAATGGACCTCTGGAAGTCGAGATA
rJMSF021M17+ TTCAGCCCNTTAGGGATATGANTGAAGGAATGCGAATGGACNTCTGGAAGTCGAGATA
                      ____________________________________________________________
consensus TATTCAGCCCTTTAGGGATATGATTGAAGGAATGCGAATGGACCTCTGGAAGTCGAGATA
 
. : . : . : . : . : . :
rJMSF024J21+ CGATAACTTTGATGAGCTATACCTGTACTGTTATTACGTTGCTGGTACGGTCGGTTTGAT
rJMSF038P07+ CGATAACTTTGATGAGCTATACCTGTACTGTTATTACGTTGCTGGTACGGTCGGTTTGAT
rJMSF021M17+ CGATAACTTTGATGAGCTATACCTGTACTGTTATTACGTTGCTGGTACGGTCGGTTTGAT
                      ____________________________________________________________
consensus CGATAACTTTGATGAGCTATACCTGTACTGTTATTACGTTGCTGGTACGGTCGGTTTGAT
 
. : . : . : . : . : . :
rJMSF024J21+ GAGTGTCCCAGTTATGGGCATTGCGCCCGAATCGAAGGCAACTACAGAGAGTGTCTACAA
rJMSF038P07+ GAGTGTCCCAGTTATGGGCATTGCGCCCGAATCGAAGGCAACTACAGAGAGTGTCTACAA
rJMSF021M17+ GAGTGTCCCAGTTATGGGCATTGCGCCCGAATCGAAGGCAACTACAGAGAGTGTCTACAA
                      ____________________________________________________________
consensus GAGTGTCCCAGTTATGGGCATTGCGCCCGAATCGAAGGCAACTACAGAGAGTGTCTACAA
 
. : . : . : . : . : . :
rJMSF024J21+ TGCCGCTTTGGCTTTAGGCATCGCAAATCAACTAACCAACATTCTCAGAGACGTAGGAGA
rJMSF038P07+ TGCCGCTTTGGCTTTAGGCATCGCAAATCAACTAACCAACATTCTCAGAGACGTAGGAGA
rJMSF021M17+ TGCCGCTTTGGCTTTAGGCATCGCAAATCAACTAACCAACATTCTCAGAGACGTAGGAGA
                      ____________________________________________________________
consensus TGCCGCTTTGGCTTTAGGCATCGCAAATCAACTAACCAACATTCTCAGAGACGTAGGAGA
 
. : . : . : . : . : . :
rJMSF024J21+ GGATGCCAGACGGGGGAGGGTGTATTTACCTCAAGATGAATTAGCTCAAGCGGGACTTTG
rJMSF038P07+ GGATGCCAGACGGGGGAGGGTGTATTTACCTCAAGATGAATTAGCTCAAGCGGGACTTTG
rJMSF046N03+ GGAGGGTGTATTTACCTCAAGATGAATTAGCTCAAGCGGGACTTTG
JMSF046N03- GGAGGGTGTATTTACCTCAAGATGAATTAGCTCAAGCGGGACTTTG
rJMSF021M17+ GGATGCCAGACGGGGGAGGGTGTATTTACCTCAAGATGAATTAGCTCAAGCGGGACTTTG
                      ____________________________________________________________
consensus GGATGCCAGACGGGGGAGGGTGTATTTACCTCAAGATGAATTAGCTCAAGCGGGACTTTG
 
. : . : . : . : . : . :
rJMSF024J21+ TGATGAGGATATATATGCTGGAAAAGTTACTGATAAGTGGAGGAACTTCATGAAGAAGCA
rJMSF038P07+ TGATGAGGATATATATGCTGGAAAAGTTACTGATAAGTGGAGGAACTTCATGAAGAAGCA
rJMSF046N03+ TGATGAGGATATATATGCTGGAAAAGTTACTGATAAGTGGAGGAACTTCATGAAGAAGCA
JMSF046N03- TGATGAGGATATATATGCTGGAAAAGTTACTGATAAGTGGAGGAACTTCATGAAGAAGCA
rJMSF021M17+ TGATGAGGATATATATGCTGGAAAAGTTACTGATAAGTGGAGGAACTTCATGAAGAAGCA
                      ____________________________________________________________
consensus TGATGAGGATATATATGCTGGAAAAGTTACTGATAAGTGGAGGAACTTCATGAAGAAGCA
 
. : . : . : . : . : . :
rJMSF024J21+ AATTAAGAGAGCAAGGAAATTCTTCGACGAGGCAGAGAGAGGTGTGACTGAACTTAGCTC
rJMSF038P07+ AATTAAGAGAGCAAGGAAATTCTTCGACGAGGCAGAGAGAGGTGTGACTGAACTTAGCTC
rJMSF046N03+ AATTAAGAGAGCAAGGAAATTCTTCGACGAGGCAGAGAGAGGTGTGACTGAACTTAGCTC
JMSF046N03- AATTAAGAGAGCAAGGAAATTCTTCGACGAGGCAGAGAGAGGTGTGACTGAACTTAGCTC
rJMSF021M17+ AATTAAGAGAGCAAGGAAATTCTTCGACGAGGCAGAGAGAGGTGTGACTGAACTTAGCTC
                      ____________________________________________________________
consensus AATTAAGAGAGCAAGGAAATTCTTCGACGAGGCAGAGAGAGGTGTGACTGAACTTAGCTC
 
. : . : . : . : . : . :
rJMSF024J21+ CGCTAGTAGATGGCCGGTGTGGGCATCGCTGCTGTTGTACCGCAAGATACTGGACGAGAT
rJMSF038P07+ CGCTAGTAGATGGCCGGTGTGGGCATCGCTGCTGTTGTACCGCAAGATACTGGACGAGAT
rJMSF046N03+ CGCTAGTAGATGGCCGGTGTGGGCATCGCTGCTGTTGTACCGCAAGATACTGGACGAGAT
JMSF046N03- CGCTAGTAGATGGCCGGTGTGGGCATCGCTGCTGTTGTACCGCAAGATACTGGACGAGAT
rJMSF021M17+ CGCTAGTAGATGGCCGGTGTGGGCATCGCTGCTGTTGTACCGCAAGATACTGGACGAGAT
                      ____________________________________________________________
consensus CGCTAGTAGATGGCCGGTGTGGGCATCGCTGCTGTTGTACCGCAAGATACTGGACGAGAT
 
. : . : . : . : . : . :
rJMSF024J21+ CGAAGCCAATGACTACAACAACTTCACGAGGAGAGCCTATGTAAGCAAGCCGAAGAAACT
rJMSF038P07+ CGAAGCCAATGACTACAACAACTTCACGAGGAGAGCCTATGTAAGCAAGCCGAAGAAACT
rJMSF046N03+ CGAAGCCAATGACTACAACAACTTCACGAGGAGAGCCTATGTAAGCAAGCCGAAGAAACT
JMSF046N03- CGAAGCCAATGACTACAACAACTTCACGAGGAGAGCCTATGTAAGCAAGCCGAAGAAACT
rJMSF021M17+ CGAAGCCAATGACTACAACAACTTCACGAGGAGAGCCTATGTAAGCAAGCCGAAGAAACT
                      ____________________________________________________________
consensus CGAAGCCAATGACTACAACAACTTCACGAGGAGAGCCTATGTAAGCAAGCCGAAGAAACT
 
. : . : . : . : . : . :
rJMSF024J21+ GCTTGCATTGCCTATTGCATATGCAAAAGCTGCGATTCGACCATCATCAACTGCTTCCCC
rJMSF038P07+ GCTTGCATTGCCTATTGCATATGCAAAAGCTGCGATTCGACCATCATCAACTGCTTCCCC
rJMSF046N03+ GCTTGCATTGCCTATTGCATATGCAAAAGCTGCGATTCGACCATCATCAACTGCTTCCCC
JMSF046N03- GCTTGCATTGCCTATTGCATATGCAAAAGCTGCGATTCGACCATCATCAACTGCTTCCCC
rJMSF021M17+ GCTTGCATTGCCTATTGCATATGCAAAAGCTGCGATTCGACCATCATCAACTGCTTCCCC
                      ____________________________________________________________
consensus GCTTGCATTGCCTATTGCATATGCAAAAGCTGCGATTCGACCATCATCAACTGCTTCCCC
 
. : . : . : . : . : . :
rJMSF024J21+ TCTGGCAAAA-GCTTGAACACAAAACTTATTATACTGTGTAATACTGTACTGAAGAAGCT
rJMSF038P07+ TCTGGCAAAA-GCTTGAACACAAAACTTATTATACTGTGTAATACTGTACTGAAGAAGCT
rJMSF046N03+ TCTGGCAAAACGCTTGAACACAAAACTTATTATACTGTGTAATACTGTACTGAAGAAGCT
JMSF046N03- TCTGGCAAAA-GCTTGAACACAAAACTTATTATACTGTGTAATACTGTACTGAAGAAGCT
rJMSF021M17+ TCTGGCAAAA-GCTTGAACACAAAACTTATTATACTGTGTAATACTGTACTGAAGAAGCT
                      ____________________________________________________________
consensus TCTGGCAAAA-GCTTGAACACAAAACTTATTATACTGTGTAATACTGTACTGAAGAAGCT
 
. : . : . : . : . : . :
rJMSF024J21+ GAAAGCATTCTGTACATTACAACCTTTGTAGTAT
rJMSF038P07+ GAAAGCATTCTGTACATTACAA-CTTTGTAGTAT
rJMSF046N03+ GAAAGCATTCTGTAC
JMSF046N03- GAAAGCATTCTGTACATTACAA-CTTTGTAGTATTGCAATGTAAAATCAACAGTAGATAG
rJMSF021M17+ GAAAGCATTCTGTACATTACAA-CTTTGTAGTATTGCAATGTAAAATCAACAGTAGATAG
                      ____________________________________________________________
consensus GAAAGCATTCTGTACATTACAA-CTTTGTAGTATTGCAATGTAAAATCAACAGTAGATAG
 
. : . : . : . : . : . :
JMSF046N03- TGAATTCAGTTTCTCACTTCCAA
rJMSF021M17+ TGAATTCAGTTTCTCACTTCCAAGTATGCCTCTTCAAGTTTCATATTCTTAACAGAGAAT
                      ____________________________________________________________
consensus TGAATTCAGTTTCTCACTTCCAAGTATGCCTCTTCAAGTTTCATATTCTTAACAGAGAAT